LOCUS       JJ776275                 265 bp    DNA     linear   GSS 03-MAY-2011
DEFINITION  SIL-045H6TV Sisymbrium irio BAC library SIL Sisymbrium irio genomic
            clone SIL-045H6, genomic survey sequence.
ACCESSION   JJ776275
VERSION     JJ776275.1
DBLINK      BioSample: SAMN00262764
KEYWORDS    GSS.
SOURCE      Sisymbrium irio
  ORGANISM  Sisymbrium irio
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
            Sisymbrieae; Sisymbrium.
REFERENCE   1  (bases 1 to 265)
  AUTHORS   Town,C.D., Tang,H., Paterson,A.H. and Pires,J.C.
  TITLE     Comparative Genomics of Sisymbrium irio
  JOURNAL   Unpublished
COMMENT     Other_GSSs: SIL-045H6TR
            Contact: Chris D. Town
            Plant Genomics
            J. Craig Venter Institute
            9704 Medical Center Dr., Rockville, MD 20850, USA
            Tel: 301-795-7523
            Fax: 301-795-7070
            Email: cdtown@jcvi.org
            Insert Length: 120000   Std Error: 0.00
            Plate: SIL-045  row: H  column: 6
            Seq primer: T7 Rev 20bp Primer (TAATACGACTCACTATAGGG)
            Class: BAC ends.
FEATURES             Location/Qualifiers
     source          1..265
                     /organism="Sisymbrium irio"
                     /mol_type="genomic DNA"
                     /strain="Gomez-Campo 1146-67"
                     /db_xref="taxon:3730"
                     /clone="SIL-045H6"
                     /clone_lib="SAMN00262764 Sisymbrium irio BAC library SIL"
                     /note="Vector: pCC1BAC; Site_1: HindIII; Constructed by
                     Amplicon Express; Transformed into Invitrogen DH10b phage
                     resistant E. coli."
BASE COUNT           88 a           54 c           56 g           67 t
ORIGIN      
        1 actagttgca taacatcact cagagatgca taaactgtta tgatacttag gtcctaacgg
       61 tgaaaccaac cgaattcgaa ggaagcaggc aatttaaaca tgtatgctgt tttcgaaaca
      121 gaaacgatta aaatgggtaa gtgaacagtt tacttcacga gttttggctt tgtccgacga
      181 aagcttggag acgacctcat ggacatccct tgaagtaacc atcttctaat cgagctacag
      241 cataatccga gaagggcaac gatct
//