LOCUS JJ776275 265 bp DNA linear GSS 03-MAY-2011 DEFINITION SIL-045H6TV Sisymbrium irio BAC library SIL Sisymbrium irio genomic clone SIL-045H6, genomic survey sequence. ACCESSION JJ776275 VERSION JJ776275.1 DBLINK BioSample: SAMN00262764 KEYWORDS GSS. SOURCE Sisymbrium irio ORGANISM Sisymbrium irio Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; malvids; Brassicales; Brassicaceae; Sisymbrieae; Sisymbrium. REFERENCE 1 (bases 1 to 265) AUTHORS Town,C.D., Tang,H., Paterson,A.H. and Pires,J.C. TITLE Comparative Genomics of Sisymbrium irio JOURNAL Unpublished COMMENT Other_GSSs: SIL-045H6TR Contact: Chris D. Town Plant Genomics J. Craig Venter Institute 9704 Medical Center Dr., Rockville, MD 20850, USA Tel: 301-795-7523 Fax: 301-795-7070 Email: cdtown@jcvi.org Insert Length: 120000 Std Error: 0.00 Plate: SIL-045 row: H column: 6 Seq primer: T7 Rev 20bp Primer (TAATACGACTCACTATAGGG) Class: BAC ends. FEATURES Location/Qualifiers source 1..265 /organism="Sisymbrium irio" /mol_type="genomic DNA" /strain="Gomez-Campo 1146-67" /db_xref="taxon:3730" /clone="SIL-045H6" /clone_lib="SAMN00262764 Sisymbrium irio BAC library SIL" /note="Vector: pCC1BAC; Site_1: HindIII; Constructed by Amplicon Express; Transformed into Invitrogen DH10b phage resistant E. coli." BASE COUNT 88 a 54 c 56 g 67 t ORIGIN 1 actagttgca taacatcact cagagatgca taaactgtta tgatacttag gtcctaacgg 61 tgaaaccaac cgaattcgaa ggaagcaggc aatttaaaca tgtatgctgt tttcgaaaca 121 gaaacgatta aaatgggtaa gtgaacagtt tacttcacga gttttggctt tgtccgacga 181 aagcttggag acgacctcat ggacatccct tgaagtaacc atcttctaat cgagctacag 241 cataatccga gaagggcaac gatct //