LOCUS       JF780977                 833 bp    DNA     linear   PLN 01-MAY-2012
DEFINITION  Alisma plantago-aquatica internal transcribed spacer 1, partial
            sequence; 5.8S ribosomal RNA gene, complete sequence; and internal
            transcribed spacer 2, partial sequence.
ACCESSION   JF780977
VERSION     JF780977.1
KEYWORDS    .
SOURCE      Alisma plantago-aquatica
  ORGANISM  Alisma plantago-aquatica
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliophyta; Liliopsida; Alismataceae; Alisma.
REFERENCE   1  (bases 1 to 833)
  AUTHORS   Chen,L.Y., Chen,J.M., Gituru,R.W., Temam,T.D. and Wang,Q.F.
  TITLE     Generic phylogeny and historical biogeography of Alismataceae,
            inferred from multiple DNA sequences
  JOURNAL   Mol. Phylogenet. Evol. 63 (2), 407-416 (2012)
   PUBMED   22327014
REFERENCE   2  (bases 1 to 833)
  AUTHORS   Chen,L.Y., Chen,J.M., Gituru,R.W. and Wang,Q.F.
  TITLE     Direct Submission
  JOURNAL   Submitted (05-APR-2011) Wuhan Botanical Garden, Chinese Academy of
            Sciences, Moshan, Wuchang, Wuhan, Hubei 430074, China
FEATURES             Location/Qualifiers
     source          1..833
                     /organism="Alisma plantago-aquatica"
                     /mol_type="genomic DNA"
                     /db_xref="taxon:15000"
                     /PCR_primers="fwd_name: ITS5, fwd_seq:
                     ggaagtaaaagtcgtaacaagg, rev_name: ITS4, rev_seq:
                     tcctccgcttattgatatgc"
     misc_RNA        <1..>833
                     /note="contains internal transcribed spacer 1, 5.8S
                     ribosomal RNA, and internal transcribed spacer 2"
BASE COUNT          157 a          225 c          241 g          208 t
ORIGIN      
        1 aaaaaaaatg taacaaggtt tccgtaggtg aacstgcgga aggatcattg tcgagaccca
       61 racgcttcat ttgttgaact cgtaaacgtg atgtgtgggc gggtgtctca tgccttggct
      121 ttgtgctgcc cgctcacacc cggcctctcc acccgcacga cattgtgggc ttctgctcgc
      181 ggtgcctgtg tggtgcgttt ggcaccaaaa caaatccccg gcgcagcccg cgccaaggat
      241 cactctagtg ccgtgcgggc tcttttgagc cactcggccg caccctaaaa gggtgcttta
      301 tcggatactt tgatgactct cggcaacgga tatctaggcc ctcgcatcga tgaagaacgt
      361 agcgaaatgc gatacttggt gtgaattgca gaatcccgtg aaccatcgag tctttgaacg
      421 caagttgcgc ccggagcctc agccgagggc acgcctgctt gggcgtcacg cctctaggcg
      481 ctcccctccc acttgagttc agcatcttga tgttggcctt gttggtggtg gatgcggatg
      541 ttggccttcc gtggctttgc cgccgcggtg ggctgaagga tgtggagtcg gtccgtccaa
      601 cgttattggg catgactgtg ctgggtcgct gctgctactg ctcgttgctc gctgggtgcg
      661 gcagtcttag caaatgcggg catcgtcgtt gtgtcgagta gccttgttgt cggactctta
      721 cgccagtaaa gttaccacga ttggtatatc agcggtcaca ccgttggttc ctcatattgc
      781 gaccccaagt caggcgggaa cacccgctga gtttaagcat atcataaaac cgg
//