LOCUS       JF268690                1792 bp    mRNA    linear   HUM 19-MAR-2011
DEFINITION  Homo sapiens PTEN splice variant (PTEN) mRNA, complete cds,
            alternatively spliced.
ACCESSION   JF268690
VERSION     JF268690.1
KEYWORDS    .
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1792)
  AUTHORS   Yang,C.-W. and Hsu,Y.-F.
  TITLE     Homo sapiens phosphatase and tensin homolog mRNA splicing variants
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 1792)
  AUTHORS   Yang,C.-W. and Hsu,Y.-F.
  TITLE     Direct Submission
  JOURNAL   Submitted (27-JAN-2011) Department of Microbiology, Soochow
            University, No. 70, Linxi Rd., Shilin Dist., Taipei, Taiwan, ROC
FEATURES             Location/Qualifiers
     source          1..1792
                     /db_xref="H-InvDB:HIT000653759"
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="10"
                     /map="10q23.3"
                     /PCR_primers="fwd_seq: gcttctgccatctctctcctc, rev_seq:
                     gtgcaaaggggtaggatgtg"
     gene            1..1792
                     /gene="PTEN"
     CDS             50..577
                     /gene="PTEN"
                     /EC_number="3.1.3.67"
                     /note="phosphatase and tensin; alternatively spliced"
                     /codon_start=1
                     /product="PTEN splice variant"
                     /protein_id="ADZ48535.1"
                     /translation="MTAIIKEIVSRNKRRYQEDGFDLDLTYIYPNIIAMGFPAERLEG
                     VYRNNIDDVVSCAERHYDTAKFNCRVAQYPFEDHNPPQLELIKPFCEDLDQWLSEDDN
                     HVAAIHCKAGKGRTGVMICAYLLHRGKFLKAQEALDFYGEVRTRDKKADPTGGIPDKG
                     IIVIGDGSSMDVIAP"
BASE COUNT          586 a          334 c          361 g          511 t
ORIGIN      
        1 gcttctgcca tctctctcct cctttttctt cagccacagg ctcccagaca tgacagccat
       61 catcaaagag atcgttagca gaaacaaaag gagatatcaa gaggatggat tcgacttaga
      121 cttgacctat atttatccaa acattattgc tatgggattt cctgcagaaa gacttgaagg
      181 cgtatacagg aacaatattg atgatgtagt aagttgtgct gaaagacatt atgacaccgc
      241 caaatttaat tgcagagttg cacaatatcc ttttgaagac cataacccac cacagctaga
      301 acttatcaaa cccttttgtg aagatcttga ccaatggcta agtgaagatg acaatcatgt
      361 tgcagcaatt cactgtaaag ctggaaaggg acgaactggt gtaatgatat gtgcatattt
      421 attacatcgg ggcaaatttt taaaggcaca agaggcccta gatttctatg gggaagtaag
      481 gaccagagac aaaaaggcag atcctacagg aggtattcca gataaaggca ttattgtcat
      541 aggagatggc agctccatgg atgttattgc cccttaagac cttccagtgg gacaagatgt
      601 ataggtggaa gacagtgata ttgatgatcc tgaccttgta gaggccaagg ctaaaggagt
      661 aactattccc agtcagaggc gctatgtgta ttattatagc tacctgttaa agaatcatct
      721 ggattataga ccagtggcac tgttgtttca caagatgatg tttgaaacta ttccaatgtt
      781 cagtggcgga acttgcaatc ctcagtttgt ggtctgccag ctaaaggtga agatatattc
      841 ctccaattca ggacccacac gacgggaaga caagttcatg tactttgagt tccctcagcc
      901 gttacctgtg tgtggtgata tcaaagtaga gttcttccac aaacagaaca agatgctaaa
      961 aaaggacaaa atgtttcact tttgggtaaa tacattcttc ataccaggac cagaggaaac
     1021 ctcagaaaaa gtagaaaatg gaagtctatg tgatcaagaa atcgatagca tttgcagtat
     1081 agagcgtgca gataatgaca aggaatatct agtacttact ttaacaaaaa atgatcttga
     1141 caaagcaaat aaagacaaag ccaaccgata cttttctcca aattttaagg tgaagctgta
     1201 cttcacaaaa acagtagagg agccgtcaaa tccagaggct agcagttcaa cttctgtaac
     1261 accagatgtt agtgacaatg aacctgatca ttatagatat tctgacacca ctgactctga
     1321 tccagagaat gaaccttttg atgaagatca gcatacacaa attacaaaag tctgaatttt
     1381 tttttatcaa gagggataaa acaccatgaa aataaacttg aataaactga aaatggacct
     1441 tttttttttt aatggcaata ggacattgtg tcagattacc agttatagga acaattctct
     1501 tttcctgacc aatcttgttt taccctatac atccacaggg ttttgacact tgttgtccag
     1561 ttgaaaaaag gttgtgtagc tgtgtcatgt atataccttt ttgtgtcaaa aggacattta
     1621 aaattcaatt aggattaata aagatggcac tttcccgttt tattccagtt ttataaaaag
     1681 tggagacaga ctgatgtgta tacgtaggaa ttttttcctt ttgtgttctg tcaccaactg
     1741 aagtggctaa agagctttgt gatatactgg ttcacatcct acccctttgc ac
//