LOCUS       HM567395                 947 bp    DNA     linear   PLN 14-OCT-2010
DEFINITION  Zingiber officinale clone Bara tRNA-Leu (trnL) gene, partial
            sequence; trnL-trnF intergenic spacer, complete sequence; and
            tRNA-Phe (trnF) gene, partial sequence; chloroplast.
ACCESSION   HM567395
VERSION     HM567395.1
KEYWORDS    .
SOURCE      chloroplast Zingiber officinale
  ORGANISM  Zingiber officinale
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliophyta; Liliopsida; Zingiberales;
            Zingiberaceae; Zingiber.
REFERENCE   1  (bases 1 to 947)
  AUTHORS   Valdiani,A.R., Sagineedu,S.R. and Pichika,M.R.
  TITLE     Phylogenetic Analysis and Classification of Malaysian Ginger
            (Zingiber officinale Rosc.)
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 947)
  AUTHORS   Valdiani,A.R., Sagineedu,S.R. and Pichika,M.R.
  TITLE     Direct Submission
  JOURNAL   Submitted (02-JUN-2010) Crop Science, Universiti Putra Malaysia,
            Serdang, Selangor 43400, Malaysia
FEATURES             Location/Qualifiers
     source          1..947
                     /organism="Zingiber officinale"
                     /organelle="plastid:chloroplast"
                     /mol_type="genomic DNA"
                     /db_xref="taxon:94328"
                     /clone="Bara"
                     /country="Malaysia"
                     /PCR_primers="fwd_name: tRNc, fwd_seq:
                     cgaaatcggtagacgctacg, rev_name: tRNf, rev_seq:
                     atttgaactggtgacacgag"
                     /note="authority: Zingiber officinale Rosc."
     misc_feature    <1..>947
                     /note="contains tRNA-Leu (trnL), trnL-trnF intergenic
                     spacer and tRNA-Phe (trnF)"
BASE COUNT          339 a          173 c          144 g          290 t
ORIGIN      
        1 gnctaattag cgaccttgta ggaacctgct agtggtaact tccaaattca gagaaaccct
       61 ggaatttaaa atgggcaatc ctgagccaaa tccttagttt tatcaaacta gaataaaaaa
      121 aaggataggt gcagagactc aatggaagct gttctaacga atgaagttga ctacgtttcg
      181 ttggtagttg gaatccgtct atcaaaatta cagaaaagat gttcctatat acctaataca
      241 tacgtataca tactgacata tcaaatcaaa cgattaatca tgactcgaat ccattatatt
      301 atatgaataa ttataatatg aaaaattcag aattagagtt attgtgaatc cagtccaatg
      361 gaagttgaaa gaagaattga atattcaatt caattattaa atcattcatt ccagagtttg
      421 atagatcttt tgaaaaactg attaattgga cgagaataaa gagagagtcc cattctacat
      481 gtcaataccg ataacaatga aatttatagt aagaggaaaa tccgtcgact ttagaaatcg
      541 tgagggttca agtccctcta tccccaataa aaaggtaatt ttacttccta aatatttatc
      601 ctcctttttt tcatcagcga ttcagttcaa acaaaattca ctatctttct cattcactcc
      661 actctttcac aacacaaatg tatccgaact aaaattcttg gatcttatcc caattttgat
      721 agatacaata cctctacaaa taaacatata tgggcaaata atctctatta ttgaatcatt
      781 cacacacagt ccatatcatt atccttacgc ttactagtta aattttttac tactttttag
      841 tccctttaat tgacatagac acaaacacta caccaggatg atgcatggga aatggtcggg
      901 atagctcagt tggtagagca gaggactgaa aatcctcgtg tcacagg
//