LOCUS G05162 251 bp DNA linear STS 28-SEP-1998 DEFINITION 2P-PCR-H Hordeum Wang&Wei Hordeum vulgare STS genomic, sequence tagged site. ACCESSION G05162 VERSION G05162.1 KEYWORDS STS. SOURCE Hordeum vulgare ORGANISM Hordeum vulgare Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; BOP clade; Pooideae; Triticodae; Triticeae; Hordeinae; Hordeum. REFERENCE 1 (bases 1 to 251) AUTHORS Wang,R.R. and Wei,J.Z. TITLE Variations of two repetitive DNA sequences in several Triticeae genomes revealed by polymerase chain reaction and sequencing JOURNAL Genome 38 (6), 1221-1229 (1995) PUBMED 8654916 COMMENT Contact: Richard Wang Forage and Range Research Laboratory USDA-ARS, Utah State University 695 N 1100 E, Logan, UT 84322-6300, USA Email: rrcwang@cc.usu.edu Primer A: ACAATCTGAAAATCTGGACA Primer B: TCATATTGAGACTCCTATAA STS size: 251 PCR Profile: Presoak: 0 degrees C for 0.00 minute(s) Denaturation: 93 degrees C for 1.00 minute(s) Annealing: 52 degrees C for 1.00 minute(s) Polymerization: 71 degrees C for 2.00 minute(s) PCR Cycles: 28 Thermal Cycler: Perkin Elmer 9600 Protocol: Template: 40 ng Primer: each 3 uM dNTPs: each 200 uM Taq Polymerase: 0.04 units/ul Total Vol: 25 ul Buffer: MgCl2: 2.5 mM KCl: 50 mM Tris-HCl: 10 mM pH: 8.3. FEATURES Location/Qualifiers source 1..251 /organism="Hordeum vulgare" /mol_type="genomic DNA" /db_xref="taxon:4513" /clone_lib="Hordeum Wang&Wei" /note="V-type: Unknown" STS 1..>251 primer_bind 1..20 BASE COUNT 81 a 37 c 55 g 78 t ORIGIN 1 acaatctgaa aatctggaca gaatttgcaa atggatgctg tgctcaaact ttgaactatg 61 gaacttgggt tctggtggaa atggggaaga tatggatagg agaagctcca caatttattt 121 gggatttttc ctggctacca aaatggtagt tcctttagaa agtgcccaaa atgcaatatt 181 ggcattaaat aggaaaaggc aatttcccct atttaattat ggccaatatt tttattggag 241 tctcaatatg a //