LOCUS       FJ493345                 347 bp    DNA     linear   PLN 11-MAY-2010
DEFINITION  Gardenia jasminoides trnL-trnF intergenic spacer, partial sequence;
            chloroplast.
ACCESSION   FJ493345
VERSION     FJ493345.1
KEYWORDS    .
SOURCE      chloroplast Gardenia jasminoides
  ORGANISM  Gardenia jasminoides
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliophyta; eudicotyledons; Gunneridae;
            Pentapetalae; asterids; lamiids; Gentianales; Rubiaceae;
            Ixoroideae; Gardenieae complex; Gardenieae - Pavetteae clade;
            Gardenieae; Gardenia.
REFERENCE   1  (bases 1 to 347)
  AUTHORS   Anthony,F., Diniz,L.E.C., Combes,M.-C. and Lashermes,P.
  TITLE     Adaptive radiation in Coffea subgenus Coffea L. (Rubiaceae) in
            Africa and Madagascar
  JOURNAL   Plant Syst. Evol. 285 (1-2), 51-64 (2010)
REFERENCE   2  (bases 1 to 347)
  AUTHORS   Anthony,F., Diniz,L.E.C., Combes,M.-C. and Lashermes,P.
  TITLE     Direct Submission
  JOURNAL   Submitted (25-NOV-2008) UMR RPB, IRD, 911 avenue d'Agropolis,
            Montpellier 34394, France
FEATURES             Location/Qualifiers
     source          1..347
                     /organism="Gardenia jasminoides"
                     /organelle="plastid:chloroplast"
                     /mol_type="genomic DNA"
                     /isolation_source="fresh leaves of plants in living
                     collection, IRD, Montpellier, France"
                     /db_xref="taxon:114476"
                     /PCR_primers="fwd_seq: ggttcaagtccctctatccc, rev_seq:
                     atttgaactggtgacacgag"
                     /note="genotype: StVdB"
     misc_feature    <1..>347
                     /note="trnL-trnF intergenic spacer; may also contain trnF
                     gene"
BASE COUNT          107 a           76 c           43 g          121 t
ORIGIN      
        1 atcccccaac tatttatcct atcccctttt cgttagcggt tcaaaatacc ttattcattt
       61 actctattct cttagaaatc aatctggacg gaaaagccct tttcttatca caaatcttgt
      121 gttatttatg atatacatat aaatgagcaa gaaataccca tttgaatggt ttacaatcga
      181 tataactact catactgaaa cttacaaagt actctttttt aagatccaag aaattctagt
      241 acctagataa aactttgtaa tcccccttcc ttcttttaat tgacatagac cccctttttc
      301 tcataaaatg aggatgctac attgggactg gtcgggatag ctcagct
//