LOCUS FC070573 627 bp mRNA linear EST 14-JUN-2011 DEFINITION sT7aVVM028C06029 VVM Vitis vinifera cDNA clone VVM028C06029 5' similar to dbj_BAE91898.1 tobacco fibrillarin homolog [Nicotiana tabacum]. Expect = 3e-87, mRNA sequence. ACCESSION FC070573 VERSION FC070573.1 DBLINK BioSample: SAMN00164509 KEYWORDS EST. SOURCE Vitis vinifera (wine grape) ORGANISM Vitis vinifera Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; Vitales; Vitaceae; Viteae; Vitis. REFERENCE 1 (bases 1 to 627) AUTHORS Tillett,R.L., Ergul,A., Albion,R.L., Schlauch,K.A., Cramer,G.R. and Cushman,J.C. TITLE Identification of tissue-specific, abiotic stress-responsive gene expression patterns in wine grape (Vitis vinifera L.) based on curation and mining of large-scale EST data sets JOURNAL BMC Plant Biol. 11 (1), 86 (2011) PUBMED 21592389 COMMENT Contact: Cushman JC Department of Biochemistry University of Nevada MS200, Reno, NV 89557-0014, USA Tel: 775-784-1918 Fax: 775-784-1650 Email: jcushman@unr.edu PCR PRimers FORWARD: T7 (TAATACGACTCACTATAGGG) BACKWARD: T3 (AATTAACCCTCACTAAAGGG) Plate: 028 row: C column: 06 Seq primer: T7 (TAATACGACTCACTATAGGG) POLYA=No. FEATURES Location/Qualifiers source 1..627 /organism="Vitis vinifera" /mol_type="mRNA" /cultivar="Cabernet Sauvignon" /db_xref="taxon:29760" /clone="VVM028C06029" /tissue_type="roots" /clone_lib="SAMN00164509 VVM" /dev_stage="10 cm high plants grown in Magenta boxes" /note="Vector: Lambda Uni-Zap XR, Bluescript SK-; Site_1: EcoRI; Site_2: XhoI; Vitis vinifera roots grown in Murashige and Skoog (1962) macro and micronutrients with Gamborg's B5 vitamins (Gamborg et al., 1968) supplemented with 1.5% sucrose, 1% agar under control conditions as well as subjected to cold (0-1.5oC), water-deficit, and 150 mM NaCl stress for 2, 4, 6 h. cDNA Library was constructed using total RNA from cold, drought, 150 mM NaCl stressed and well watered Vitis vinifera roots. Total RNAs from different treatments were extracted and equal amounts were pooled before mRNA selection. Poly(A)+mRNA was isolated from total RNA using the Oligotex Direct mRNA kit (Qiagen). cDNA synthesis was conducted by coverting poly(A)+mRNA to double - stranded cDNA by using primer: 5'-AACTGGAAGAATTCGCGGCCGCTCGCATTTTTTTTTTTTTTTTTTV-3' (V=A,C,G) and Superscript III (Invitrogen). Double stranded cDNAs were size selected (more than 600 bp), adaptored with EcoRI adaptors (aattccgttgctgtcg - Promega # C1291) and digested with NotI. The cDNAs were then directionally cloned into EcoRI-NotI digested pBluescript II SK+ phagemid vector (Stratagene). The total number of white colony forming units (cfu) before amplification was 3x106. Blue colonies (empty vectors) were less than 10%. Purified plasmid DNA from the primary library was converted to single-stranded circles and used as a template for PCR amplification using the T7 and T3 priming sites flanking the cloned cDNA inserts as previously described (Bonaldo M, Lennon G, and Soares MB (1996) Normalization and subtraction: two approaches to facilitate gene discovery. Genome Research 9:791-806). The purified PCR products, representing the entire cloned cDNA population, were used as a driver for normalization. Hybridization between the single-stranded library (50ng) and the PCR products (500ng) was carried out for 44 hours at 30oC. Unhybridized single-stranded DNA circles were separated from hybridized DNA rendered partially double-stranded and electroporated into DH10B cells to generate the normalized library. The total number of clones with insert was: 1.6x106 cfu. Background of empty clones was less than 10%." BASE COUNT 145 a 110 c 227 g 145 t ORIGIN 1 acccttagca gagatgagac ctccagcagg aagaggccgt ggaggtggcg gtttcggagg 61 tggcggtttc agaggcagag gcgatggagg aaggggcaga ggcagaggag ggtttggtgg 121 aagaggtggc agtgacatga acagccgggg tggtggtcgt ggcgaccgtg gtggtcgtgg 181 tggtcgtggc ggcgggagag gccgtggtgg acgcggaggt ggcggaatga aaggtggaag 241 cagggttgta gttgagcccc ataggcatga gggggtgttc attgctaagg gcaaagaaga 301 tgcacttgtt actaagaata tggtccccgg agaagccgtc tacaatgaga aaagaatctc 361 tgttcagaat gaagatggaa gcaaaattga atacagggtt tggaacccct tccgttcaaa 421 gttggctgct gccattcttg gtggtgttga tgagatctgg attaaacctg gtgctcgagt 481 tctctacctt ggtgctgcct cagggaccac tgtttcccat gtctcggatg ttgttggccc 541 tactggagtg gtttatgcag tggaattttc tcacagaagt ggtagggact tggttaacat 601 ggcaaagaag cggacaaatg ttattcc //