LOCUS       DQ445157                 232 bp    DNA     linear   PLN 01-JUL-2007
DEFINITION  Curcuma phaeocaulis voucher M.Ardiyani73(E) internal transcribed
            spacer 2, complete sequence.
ACCESSION   DQ445157
VERSION     DQ445157.1
KEYWORDS    .
SOURCE      Curcuma phaeocaulis
  ORGANISM  Curcuma phaeocaulis
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; Liliopsida; Zingiberales;
            Zingiberaceae; Curcuma.
REFERENCE   1  (bases 1 to 232)
  AUTHORS   Ardiyani,M., Newman,M.F. and Cronk,Q.C.B.
  TITLE     Phylogenetic Study of Curcuma longa L. (Zingiberaceae), turmeric
            and its allies using internal transcribed spacers (ITS) from nrDNA
            and trnL-F from cpDNA
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 232)
  AUTHORS   Ardiyani,M., Newman,M.F. and Cronk,Q.C.B.
  TITLE     Direct Submission
  JOURNAL   Submitted (09-MAR-2006) Herbarium Bogoriense, Indonesian Institute
            of Sciences, Jl. Ir. H. Juanda 22, Bogor, West Java 16610,
            Indonesia
FEATURES             Location/Qualifiers
     source          1..232
                     /organism="Curcuma phaeocaulis"
                     /mol_type="genomic DNA"
                     /specimen_voucher="M.Ardiyani73(E)"
                     /db_xref="taxon:136218"
                     /tissue_type="leaf"
                     /country="Indonesia"
                     /PCR_primers="fwd_name: ITS3P, fwd_seq:
                     gcatcgatgaagaacgtagc, rev_name: ITS8P, rev_seq:
                     cacgcttctccagactaca"
                     /note="authority: Curcuma phaeocaulis Valeton"
     misc_RNA        1..232
                     /product="internal transcribed spacer 2"
BASE COUNT           40 a           61 c           74 g           54 t
ORIGIN      
        1 atmgtcgctt ttgctccatg ctttgtcggc attgagcgcg gaagttggcc ccgtgtgccc
       61 tcgggcacag tcggtcgaag agcgggtagt cggtaatcgt cgagcacgat ggacgttggt
      121 cgtcgcgagc gagaactgaa cgtcgtcctc gtcgttttgg gatgagccct caagagaccc
      181 tgtgtgatwg atgattgcrg acccgcgcga aagccccgcg tcaatcattt gc
//