LOCUS       CP002688            26975502 bp    DNA     linear   PLN 20-JUL-2017
DEFINITION  Arabidopsis thaliana chromosome 5 sequence.
VERSION     CP002688.1
DBLINK      BioProject: PRJNA10719
            BioSample: SAMN03081427
SOURCE      Arabidopsis thaliana (thale cress)
  ORGANISM  Arabidopsis thaliana
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliophyta; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
            Camelineae; Arabidopsis.
REFERENCE   1  (bases 1 to 26975502)
  AUTHORS   Tabata,S., Kaneko,T., Nakamura,Y., Kotani,H., Kato,T., Asamizu,E.,
            Miyajima,N., Sasamoto,S., Kimura,T., Hosouchi,T., Kawashima,K.,
            Kohara,M., Matsumoto,M., Matsuno,A., Muraki,A., Nakayama,S.,
            Nakazaki,N., Naruo,K., Okumura,S., Shinpo,S., Takeuchi,C., Wada,T.,
            Watanabe,A., Yamada,M., Yasuda,M., Sato,S., de la Bastide,M.,
            Huang,E., Spiegel,L., Gnoj,L., O'Shaughnessy,A., Preston,R.,
            Habermann,K., Murray,J., Johnson,D., Rohlfing,T., Nelson,J.,
            Stoneking,T., Pepin,K., Spieth,J., Sekhon,M., Armstrong,J.,
            Becker,M., Belter,E., Cordum,H., Cordes,M., Courtney,L.,
            Courtney,W., Dante,M., Du,H., Edwards,J., Fryman,J., Haakensen,B.,
            Lamar,E., Latreille,P., Leonard,S., Meyer,R., Mulvaney,E.,
            Ozersky,P., Riley,A., Strowmatt,C., Wagner-McPherson,C., Wollam,A.,
            Yoakum,M., Bell,M., Dedhia,N., Parnell,L., Shah,R., Rodriguez,M.,
            See,L.H., Vil,D., Baker,J., Kirchoff,K., Toth,K., King,L.,
            Bahret,A., Miller,B., Marra,M., Martienssen,R., McCombie,W.R.,
            Wilson,R.K., Murphy,G., Bancroft,I., Volckaert,G., Wambutt,R.,
            Dusterhoft,A., Stiekema,W., Pohl,T., Entian,K.D., Terryn,N.,
            Hartley,N., Bent,E., Johnson,S., Langham,S.A., McCullagh,B.,
            Robben,J., Grymonprez,B., Zimmermann,W., Ramsperger,U., Wedler,H.,
            Balke,K., Wedler,E., Peters,S., van Staveren,M., Dirkse,W.,
            Mooijman,P., Lankhorst,R.K., Weitzenegger,T., Bothe,G., Rose,M.,
            Hauf,J., Berneiser,S., Hempel,S., Feldpausch,M., Lamberth,S.,
            Villarroel,R., Gielen,J., Ardiles,W., Bents,O., Lemcke,K.,
            Kolesov,G., Mayer,K., Rudd,S., Schoof,H., Schueller,C.,
            Zaccaria,P., Mewes,H.W., Bevan,M. and Fransz,P.
  CONSRTM   Kazusa DNA Research Institute; Cold Spring Harbor and Washington
            University in St Louis Sequencing Consortium; European Union
            Arabidopsis Genome Sequencing Consortium
  TITLE     Sequence and analysis of chromosome 5 of the plant Arabidopsis
  JOURNAL   Nature 408 (6814), 823-826 (2000)
   PUBMED   11130714
REFERENCE   2  (bases 1 to 26975502)
  AUTHORS   Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E.
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2011) Department of Plant Biology, Carnegie
            Institution, 260 Panama Street, Stanford, CA, USA
REFERENCE   3  (bases 1 to 26975502)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
FEATURES             Location/Qualifiers
     source          1..26975502
                     /organism="Arabidopsis thaliana"
                     /mol_type="genomic DNA"
     gene            2..303
     ncRNA           2..303
                     /product="other RNA"
     gene            complement(995..5156)
     mRNA            complement(join(995..1225,1373..1459,1572..1646,
                     /product="retinal-binding protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:BX841661.1"
     mRNA            complement(join(999..1225,1337..1459,1572..1646,
                     /product="retinal-binding protein"
     mRNA            complement(join(1034..1459,1572..1646,1745..1780,
                     /product="retinal-binding protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     mRNA            complement(join(1279..1646,1745..1780,1914..1961,
                     /product="retinal-binding protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:BX841661.1"
     mRNA            complement(join(1279..1459,1572..1646,1745..1780,
                     /product="retinal-binding protein"
     CDS             complement(join(1388..1459,1572..1646,1745..1780,
                     /note="EXPRESSED IN: 23 plant structures; EXPRESSED
                     DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: GOLD
                     /product="retinal-binding protein"
     CDS             complement(join(1388..1459,1572..1646,1745..1780,
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="CONTAINS InterPro DOMAIN/s: GOLD
                     (InterPro:IPR009038); Has 172 Blast hits to 172 proteins
                     in 43 species: Archae - 0; Bacteria - 0; Metazoa - 95;
                     Fungi - 0; Plants - 63; Viruses - 0; Other Eukaryotes - 14
                     (source: NCBI BLink)."
                     /product="retinal-binding protein"
     CDS             complement(join(1388..1459,1572..1646,1745..1780,
                     /product="retinal-binding protein"
     CDS             complement(join(1388..1459,1572..1646,1745..1780,
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:BX841661.1"
                     /note="EXPRESSED IN: 23 plant structures; EXPRESSED
                     DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: GOLD
                     (InterPro:IPR009038); Has 85 Blast hits to 85 proteins in
                     21 species: Archae - 0; Bacteria - 0; Metazoa - 20; Fungi
                     - 0; Plants - 62; Viruses - 0; Other Eukaryotes - 3
                     (source: NCBI BLink)."
                     /product="retinal-binding protein"
     CDS             complement(join(1527..1646,1745..1780,1914..1961,
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:BX841661.1"
                     /note="EXPRESSED IN: 23 plant structures; EXPRESSED
                     DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: GOLD
                     (InterPro:IPR009038); Has 76 Blast hits to 76 proteins in
                     20 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi
                     - 0; Plants - 62; Viruses - 0; Other Eukaryotes - 3
                     (source: NCBI BLink)."
                     /product="retinal-binding protein"
     gene            complement(5256..5907)
     mRNA            complement(join(5256..5576,5697..5907))
                     /product="transmembrane protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             complement(join(5335..5576,5697..5769))
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="unknown protein; FUNCTIONS IN: molecular_function
                     unknown; INVOLVED IN: biological_process unknown; LOCATED
                     IN: endomembrane system; EXPRESSED IN: 23 plant
                     structures; EXPRESSED DURING: 13 growth stages; BEST
                     Arabidopsis thaliana protein match is: unknown protein
                     (TAIR:AT1G65295.1); Has 30201 Blast hits to 17322 proteins
                     in 780 species: Archae - 12; Bacteria - 1396; Metazoa -
                     17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other
                     Eukaryotes - 2996 (source: NCBI BLink)."
                     /product="transmembrane protein"
     gene            5339..5593
     mRNA            5339..5593
                     /product="hypothetical protein"
     CDS             5339..5593
                     /product="hypothetical protein"
     mRNA            complement(join(5367..5576,5687..5801))
                     /product="transmembrane protein"
     CDS             complement(join(5516..5576,5687..5769))
                     /note="unknown protein; FUNCTIONS IN: molecular_function
                     unknown; INVOLVED IN: biological_process unknown; LOCATED
                     IN: endomembrane system; EXPRESSED IN: 23 plant
                     structures; EXPRESSED DURING: 13 growth stages."
                     /product="transmembrane protein"
     gene            complement(5917..8467)
     mRNA            complement(join(5917..6790,7212..7335,7440..7576,
                     /product="Protein kinase superfamily protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             complement(join(6309..6790,7212..7335,7440..7576,
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="Protein kinase superfamily protein; FUNCTIONS IN:
                     protein serine/threonine kinase activity, protein kinase
                     activity, kinase activity, ATP binding; INVOLVED IN:
                     protein amino acid phosphorylation, N-terminal protein
                     myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN:
                     22 plant structures; EXPRESSED DURING: 13 growth stages;
                     CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding
                     site (InterPro:IPR017441), Protein kinase, catalytic
                     domain (InterPro:IPR000719), Serine/threonine-protein
                     kinase-like domain (InterPro:IPR017442), Protein
                     kinase-like domain (InterPro:IPR011009),
                     Serine/threonine-protein kinase, active site
                     (InterPro:IPR008271); BEST Arabidopsis thaliana protein
                     match is: Protein kinase superfamily protein
                     (TAIR:AT2G05940.1); Has 117465 Blast hits to 116000
                     proteins in 4235 species: Archae - 97; Bacteria - 13843;
                     Metazoa - 43298; Fungi - 9750; Plants - 33095; Viruses -
                     372; Other Eukaryotes - 17010 (source: NCBI BLink)."
                     /product="Protein kinase superfamily protein"
     gene            9780..13235
     mRNA            join(9780..10172,10574..12665,12797..13235)
                     /product="enolase, putative (DUF3527)"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     mRNA            join(9780..10172,10620..12665,12797..13235)
                     /product="enolase, putative (DUF3527)"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     mRNA            join(9869..12665,12797..13003)
                     /product="enolase, putative (DUF3527)"
     CDS             join(10638..12665,12797..13003)
                     /product="enolase, putative (DUF3527)"
     CDS             join(10638..12665,12797..13003)
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="Protein of unknown function (DUF3527); FUNCTIONS
                     IN: molecular_function unknown; INVOLVED IN:
                     biological_process unknown; LOCATED IN: cellular_component
                     unknown; EXPRESSED IN: 24 plant structures; EXPRESSED
                     DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s:
                     Protein of unknown function DUF3527 (InterPro:IPR021916);
                     BEST Arabidopsis thaliana protein match is: Protein of
                     unknown function (DUF3527) (TAIR:AT2G37930.1); Has 1807
                     Blast hits to 1807 proteins in 277 species: Archae - 0;
                     Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385;
                     Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink)."
                     /product="enolase, putative (DUF3527)"
     CDS             join(10638..12665,12797..13003)
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="Protein of unknown function (DUF3527); FUNCTIONS
                     IN: molecular_function unknown; INVOLVED IN:
                     biological_process unknown; LOCATED IN: cellular_component
                     unknown; EXPRESSED IN: 24 plant structures; EXPRESSED
                     DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s:
                     Protein of unknown function DUF3527 (InterPro:IPR021916);
                     BEST Arabidopsis thaliana protein match is: Protein of
                     unknown function (DUF3527) (TAIR:AT2G37930.1); Has 286
                     Blast hits to 251 proteins in 78 species: Archae - 0;
                     Bacteria - 81; Metazoa - 28; Fungi - 27; Plants - 128;
                     Viruses - 0; Other Eukaryotes - 22 (source: NCBI BLink)."
                     /product="enolase, putative (DUF3527)"
     gene            complement(13128..16236)
                     /gene_synonym="laccase 8"
                     /note="putative laccase, knockout mutant showed early
     mRNA            complement(join(13128..13578,13703..14665,14764..14874,
                     /gene_synonym="laccase 8"
                     /product="laccase 8"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             complement(join(13394..13578,13703..14665,14764..14874,
                     /gene_synonym="laccase 8"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="laccase 8 (LAC8); FUNCTIONS IN: laccase activity;
                     INVOLVED IN: vegetative to reproductive phase transition
                     of meristem, response to copper ion; LOCATED IN:
                     endomembrane system, apoplast; EXPRESSED IN: fruit, root,
                     flower; CONTAINS InterPro DOMAIN/s: Multicopper oxidase,
                     type 2 (InterPro:IPR011706), Multicopper oxidase, type 3
                     (InterPro:IPR011707), Laccase (InterPro:IPR017761),
                     Cupredoxin (InterPro:IPR008972), Multicopper oxidase, type
                     1 (InterPro:IPR001117); BEST Arabidopsis thaliana protein
                     match is: Laccase/Diphenol oxidase family protein
                     (TAIR:AT5G01050.1); Has 1807 Blast hits to 1807 proteins
                     in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736;
                     Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes -
                     339 (source: NCBI BLink)."
                     /product="laccase 8"
     gene            complement(18086..20887)
                     /note="putative laccase, a member of laccase family of
                     genes (17 members in Arabidopsis)."
     mRNA            complement(join(18086..18393,18481..19449,19570..19680,
                     /product="Laccase/Diphenol oxidase family protein"
                     /inference="Similar to RNA sequence, EST:INSD:AV548905.1"
     CDS             complement(join(18209..18393,18481..19449,19570..19680,
                     /inference="Similar to RNA sequence, EST:INSD:AV548905.1"
                     /note="Laccase/Diphenol oxidase family protein; FUNCTIONS
                     IN: laccase activity; INVOLVED IN: oxidation reduction,
                     lignin catabolic process; LOCATED IN: endomembrane system,
                     apoplast; EXPRESSED IN: root, flower; CONTAINS InterPro
                     DOMAIN/s: Multicopper oxidase, type 3
                     (InterPro:IPR011707), Laccase (InterPro:IPR017761),
                     Multicopper oxidase, type 2 (InterPro:IPR011706),
                     Cupredoxin (InterPro:IPR008972), Multicopper oxidase, type
                     1 (InterPro:IPR001117); BEST Arabidopsis thaliana protein
                     match is: laccase 8 (TAIR:AT5G01040.1); Has 1807 Blast
                     hits to 1807 proteins in 277 species: Archae - 0; Bacteria
                     - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses -
                     0; Other Eukaryotes - 339 (source: NCBI BLink)."
                     /product="Laccase/Diphenol oxidase family protein"
     gene            22684..24934
                     /gene_synonym="brassinosteroid-signaling kinase 10"
     mRNA            join(22684..23271,23359..23492,23580..23771,23858..24079,
                     /gene_synonym="brassinosteroid-signaling kinase 10"
                     /product="kinase with tetratricopeptide repeat
                     domain-containing protein"
     mRNA            join(22684..23054,23136..23271,23359..23492,23580..23771,
                     /gene_synonym="brassinosteroid-signaling kinase 10"
                     /product="kinase with tetratricopeptide repeat
                     domain-containing protein"
     mRNA            join(22686..23054,23136..23271,23359..23492,23580..23771,
                     /gene_synonym="brassinosteroid-signaling kinase 10"
                     /product="kinase with tetratricopeptide repeat
                     domain-containing protein"
     CDS             join(22740..23054,23136..23271,23359..23492,23580..23771,
                     /gene_synonym="brassinosteroid-signaling kinase 10"
                     /note="Protein kinase protein with tetratricopeptide
                     repeat domain; FUNCTIONS IN: binding, protein kinase
                     activity, kinase activity, ATP binding; INVOLVED IN:
                     protein amino acid phosphorylation, N-terminal protein
                     myristoylation; LOCATED IN: cellular_component unknown;
                     EXPRESSED IN: petal, cotyledon, root; EXPRESSED DURING:
                     petal differentiation and expansion stage; CONTAINS
                     InterPro DOMAIN/s: Tetratricopeptide-like helical
                     (InterPro:IPR011990), Protein kinase, catalytic domain
                     (InterPro:IPR000719), Serine-threonine/tyrosine-protein
                     kinase (InterPro:IPR001245), Protein kinase-like domain
                     (InterPro:IPR011009); BEST Arabidopsis thaliana protein
                     match is: Protein kinase protein with tetratricopeptide
                     repeat domain (TAIR:AT3G09240.1); Has 1807 Blast hits to
                     1807 proteins in 277 species: Archae - 0; Bacteria - 0;
                     Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0;
                     Other Eukaryotes - 339 (source: NCBI BLink)."
                     /product="kinase with tetratricopeptide repeat
                     domain-containing protein"
     CDS             join(22740..23054,23136..23271,23359..23492,23580..23771,
                     /gene_synonym="brassinosteroid-signaling kinase 10"
                     /product="kinase with tetratricopeptide repeat
                     domain-containing protein"
     CDS             join(23175..23271,23359..23492,23580..23771,23858..24079,
                     /gene_synonym="brassinosteroid-signaling kinase 10"
                     /product="kinase with tetratricopeptide repeat
                     domain-containing protein"
     gene            complement(25012..25908)
     mRNA            complement(join(25012..25343,25429..25908))
                     /product="RING/FYVE/PHD zinc finger superfamily protein"
                     /inference="similar to RNA sequence,
     CDS             complement(join(25094..25343,25429..25799))
                     /inference="similar to RNA sequence,
                     /note="RING/FYVE/PHD zinc finger superfamily protein;
                     FUNCTIONS IN: zinc ion binding; CONTAINS InterPro
                     DOMAIN/s: Zinc finger, C3HC4 RING-type
                     (InterPro:IPR018957), Zinc finger, RING-CH-type
                     (InterPro:IPR011016); BEST Arabidopsis thaliana protein
                     match is: RING/FYVE/PHD zinc finger superfamily protein
                     (TAIR:AT2G37950.1); Has 1807 Blast hits to 1807 proteins
                     in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736;
                     Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes -
                     339 (source: NCBI BLink)."
                     /product="RING/FYVE/PHD zinc finger superfamily protein"
     gene            complement(26848..27504)
     mRNA            complement(join(26848..27267,27351..27504))
                     /product="Glycosyl hydrolase family 35 protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             complement(join(27095..27267,27351..27423))
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="Glycosyl hydrolase family 35 protein; FUNCTIONS IN:
                     hydrolase activity, hydrolyzing O-glycosyl compounds;
                     INVOLVED IN: carbohydrate metabolic process; LOCATED IN:
                     endomembrane system; EXPRESSED IN: 19 plant structures;
                     EXPRESSED DURING: 13 growth stages; CONTAINS InterPro
                     DOMAIN/s: Glycoside hydrolase, family 35
                     (InterPro:IPR001944); Has 30201 Blast hits to 17322
                     proteins in 780 species: Archae - 12; Bacteria - 1396;
                     Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0;
                     Other Eukaryotes - 2996 (source: NCBI BLink)."
                     /product="Glycosyl hydrolase family 35 protein"
     gene            complement(28532..29086)
     mRNA            complement(28532..29086)
                     /product="Beta-galactosidase related protein"
                     /inference="Similar to RNA sequence, EST:INSD:ES063959.1"
     CDS             complement(28532..29086)
                     /inference="Similar to RNA sequence, EST:INSD:ES063959.1"
                     /note="Beta-galactosidase related protein; FUNCTIONS IN:
                     hydrolase activity, hydrolyzing O-glycosyl compounds;
                     INVOLVED IN: carbohydrate metabolic process; CONTAINS
                     InterPro DOMAIN/s: Glycoside hydrolase, family 35
                     (InterPro:IPR001944); BEST Arabidopsis thaliana protein
                     match is: Beta-galactosidase related protein
                     (TAIR:AT5G35760.1); Has 30201 Blast hits to 17322 proteins
                     in 780 species: Archae - 12; Bacteria - 1396; Metazoa -
                     17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other
                     Eukaryotes - 2996 (source: NCBI BLink)."
                     /product="Beta-galactosidase related protein"
     gene            complement(30097..30877)
     misc_RNA        complement(join(30097..30402,30760..30877))
                     /note="novel transcribed region;
     gene            32780..34376
     mRNA            32780..34376
                     /product="Concanavalin A-like lectin family protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             33055..34116
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="Concanavalin A-like lectin family protein;
                     FUNCTIONS IN: carbohydrate binding, binding; INVOLVED IN:
                     biological_process unknown; LOCATED IN: endomembrane
                     system; EXPRESSED IN: 22 plant structures; EXPRESSED
                     DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s:
                     Legume lectin, beta chain (InterPro:IPR001220),
                     Concanavalin A-like lectin/glucanase, subgroup
                     (InterPro:IPR013320), Concanavalin A-like lectin/glucanase
                     (InterPro:IPR008985); BEST Arabidopsis thaliana protein
                     match is: Concanavalin A-like lectin family protein
                     (TAIR:AT3G09190.1); Has 1807 Blast hits to 1807 proteins
                     in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736;
                     Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes -
                     339 (source: NCBI BLink)."
                     /product="Concanavalin A-like lectin family protein"
     gene            complement(34538..37999)
                     /gene_synonym="FRIABLE 1"
     mRNA            complement(join(34538..35133,35219..35695,35787..36019,
                     /gene_synonym="FRIABLE 1"
                     /product="O-fucosyltransferase family protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             complement(join(34872..35133,35219..35695,35787..36019,
                     /gene_synonym="FRIABLE 1"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="O-fucosyltransferase family protein; CONTAINS
                     InterPro DOMAIN/s: GDP-fucose protein O-fucosyltransferase
                     (InterPro:IPR019378); BEST Arabidopsis thaliana protein
                     match is: O-fucosyltransferase family protein
                     (TAIR:AT3G54100.1); Has 1807 Blast hits to 1807 proteins
                     in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736;
                     Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes -
                     339 (source: NCBI BLink)."
                     /product="O-fucosyltransferase family protein"
     gene            40704..41104
     ncRNA           40704..41104
                     /product="other RNA"
     gene            complement(40858..41104)
     ncRNA           complement(40858..41104)
                     /product="other RNA"
     gene            complement(41768..44512)
     mRNA            complement(41768..44512)
                     /product="Tetratricopeptide repeat (TPR)-like superfamily
     mRNA            complement(41768..44375)
                     /product="Tetratricopeptide repeat (TPR)-like superfamily
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             complement(42114..44387)
                     /product="Tetratricopeptide repeat (TPR)-like superfamily
     CDS             complement(42114..44303)
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="Tetratricopeptide repeat (TPR)-like superfamily
                     protein; LOCATED IN: chloroplast; CONTAINS InterPro
                     DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885);
                     BEST Arabidopsis thaliana protein match is:
                     Pentatricopeptide repeat (PPR-like) superfamily protein
                     (TAIR:AT1G05670.2); Has 1807 Blast hits to 1807 proteins
                     in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736;
                     Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes -
                     339 (source: NCBI BLink)."
                     /product="Tetratricopeptide repeat (TPR)-like superfamily
     gene            44810..47206
     mRNA            join(44810..44896,45281..45928,46012..46761,46852..47206)
                     /product="hypothetical protein (DUF674)"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AY735669.1"
     CDS             join(45281..45928,46012..46761,46852..46986)
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AY735669.1"
                     /note="Protein of unknown function (DUF674); CONTAINS
                     InterPro DOMAIN/s: Protein of unknown function DUF674
                     (InterPro:IPR007750); BEST Arabidopsis thaliana protein
                     match is: Protein of unknown function (DUF674)
                     (TAIR:AT5G43240.3); Has 1807 Blast hits to 1807 proteins
                     in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736;
                     Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes -
                     339 (source: NCBI BLink)."
                     /product="hypothetical protein (DUF674)"
     gene            47570..49512
     mRNA            join(47570..48253,48355..49005,49079..49199,49283..49512)
                     /product="hypothetical protein (DUF674)"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:DQ653258.1"
     CDS             join(47642..48253,48355..49005,49079..49174)
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:DQ653258.1"
                     /note="Protein of unknown function (DUF674); CONTAINS
                     InterPro DOMAIN/s: Protein of unknown function DUF674
                     (InterPro:IPR007750); BEST Arabidopsis thaliana protein
                     match is: Protein of unknown function (DUF674)
                     (TAIR:AT5G01150.1); Has 30201 Blast hits to 17322 proteins
                     in 780 species: Archae - 12; Bacteria - 1396; Metazoa -
                     17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other
                     Eukaryotes - 2996 (source: NCBI BLink)."
                     /product="hypothetical protein (DUF674)"
     gene            49891..51437
     mRNA            join(49891..49975,50024..51222,51300..51437)
                     /product="hypothetical protein (DUF674)"
     CDS             join(49891..49975,50024..51222,51300..51437)
                     /note="Protein of unknown function (DUF674); CONTAINS
                     InterPro DOMAIN/s: Protein of unknown function DUF674
                     (InterPro:IPR007750); BEST Arabidopsis thaliana protein
                     match is: Protein of unknown function (DUF674)
                     (TAIR:AT5G01150.1); Has 1807 Blast hits to 1807 proteins
                     in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736;
                     Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes -
                     339 (source: NCBI BLink)."
                     /product="hypothetical protein (DUF674)"
     gene            51975..53817
     mRNA            join(51975..52623,52708..53439,53512..53817)
                     /product="hypothetical protein (DUF674)"
                     /inference="Similar to RNA sequence,
     CDS             join(51988..52623,52708..53439,53512..53649)
                     /inference="Similar to RNA sequence,
                     /note="Protein of unknown function (DUF674); CONTAINS
                     InterPro DOMAIN/s: Protein of unknown function DUF674
                     (InterPro:IPR007750); BEST Arabidopsis thaliana protein
                     match is: Protein of unknown function (DUF674)
                     (TAIR:AT5G01130.1); Has 1807 Blast hits to 1807 proteins
                     in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736;
                     Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes -
                     339 (source: NCBI BLink)."
                     /product="hypothetical protein (DUF674)"
     gene            53856..56052
     mRNA            join(53856..54534,54657..54715,54959..56052)
                     /product="RING/U-box superfamily protein"
     mRNA            join(53856..54196,54275..54534,54657..54715,54959..56052)
                     /product="RING/U-box superfamily protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             join(54280..54534,54657..54715,54959..55727)
                     /product="RING/U-box superfamily protein"
     CDS             join(54280..54534,54657..54715,54959..55727)
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="RING/U-box superfamily protein; FUNCTIONS IN: zinc
                     ion binding; INVOLVED IN: biological_process unknown;
                     LOCATED IN: intracellular; EXPRESSED IN: 24 plant
                     structures; EXPRESSED DURING: 15 growth stages; CONTAINS
                     InterPro DOMAIN/s: Zinc finger, C2H2-like
                     (InterPro:IPR015880), Zinc finger, RING-type, conserved
                     site (InterPro:IPR017907), Zinc finger, RING-type
                     (InterPro:IPR001841), Zinc finger, C2H2-type
                     (InterPro:IPR007087); Has 1807 Blast hits to 1807 proteins
                     in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736;
                     Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes -
                     339 (source: NCBI BLink)."
                     /product="RING/U-box superfamily protein"
     gene            58011..60136
     mRNA            58011..60136
                     /product="hypothetical protein (DUF740)"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             58315..60021
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="Protein of unknown function (DUF740); CONTAINS
                     InterPro DOMAIN/s: Protein of unknown function DUF740
                     (InterPro:IPR008004); BEST Arabidopsis thaliana protein
                     match is: Protein of unknown function (DUF740)
                     (TAIR:AT3G09070.1); Has 1807 Blast hits to 1807 proteins
                     in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736;
                     Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes -
                     339 (source: NCBI BLink)."
                     /product="hypothetical protein (DUF740)"
     gene            60208..61214
                     /note="Natural antisense transcript overlaps with
                     Potential natural antisense gene, locus overlaps with
     ncRNA           60208..61214
                     /product="other RNA"
     ncRNA           join(60208..60437,60917..61214)
                     /product="other RNA"
     gene            complement(61017..63936)
                     /gene_synonym="ARABIDOPSIS THALIANA PEPTIDE TRANSPORTER 5"
                     /gene_synonym="NRT1/ PTR family 8.2"
                     /gene_synonym="peptide transporter 5"
                     /gene_synonym="peptide transporter 5"
                     /note="Encodes a dipeptide transporter expressed in pollen
                     and ovules during early seed development. GFP-tagged PTR5
                     localizes to the plasma membrane."
     mRNA            complement(join(61017..62091,62166..62716,62818..63035,
                     /gene_synonym="ARABIDOPSIS THALIANA PEPTIDE TRANSPORTER 5"
                     /gene_synonym="NRT1/ PTR family 8.2"
                     /gene_synonym="peptide transporter 5"
                     /gene_synonym="peptide transporter 5"
                     /product="peptide transporter 5"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     mRNA            complement(join(61257..62091,62166..62716,62818..63035,
                     /gene_synonym="ARABIDOPSIS THALIANA PEPTIDE TRANSPORTER 5"
                     /gene_synonym="NRT1/ PTR family 8.2"
                     /gene_synonym="peptide transporter 5"
                     /gene_synonym="peptide transporter 5"
                     /product="peptide transporter 5"
     mRNA            complement(join(61257..62091,62166..62716,62818..63035,
                     /gene_synonym="ARABIDOPSIS THALIANA PEPTIDE TRANSPORTER 5"
                     /gene_synonym="NRT1/ PTR family 8.2"
                     /gene_synonym="peptide transporter 5"
                     /gene_synonym="peptide transporter 5"
                     /product="peptide transporter 5"
     CDS             complement(join(61257..62091,62166..62716,62818..63035,
                     /gene_synonym="ARABIDOPSIS THALIANA PEPTIDE TRANSPORTER 5"
                     /gene_synonym="NRT1/ PTR family 8.2"
                     /gene_synonym="peptide transporter 5"
                     /gene_synonym="peptide transporter 5"
                     /product="peptide transporter 5"
     CDS             complement(join(61257..62091,62166..62716,62818..63035,
                     /gene_synonym="ARABIDOPSIS THALIANA PEPTIDE TRANSPORTER 5"
                     /gene_synonym="NRT1/ PTR family 8.2"
                     /gene_synonym="peptide transporter 5"
                     /gene_synonym="peptide transporter 5"
                     /product="peptide transporter 5"
     CDS             complement(join(61257..62091,62166..62716,62818..63035,
                     /gene_synonym="ARABIDOPSIS THALIANA PEPTIDE TRANSPORTER 5"
                     /gene_synonym="NRT1/ PTR family 8.2"
                     /gene_synonym="peptide transporter 5"
                     /gene_synonym="peptide transporter 5"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="peptide transporter 5 (PTR5); CONTAINS InterPro
                     DOMAIN/s: PTR2 family proton/oligopeptide symporter,
                     conserved site (InterPro:IPR018456), Oligopeptide
                     transporter (InterPro:IPR000109), Major facilitator
                     superfamily, general substrate transporter
                     (InterPro:IPR016196); BEST Arabidopsis thaliana protein
                     match is: peptide transporter 1 (TAIR:AT3G54140.1); Has
                     1807 Blast hits to 1807 proteins in 277 species: Archae -
                     0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385;
                     Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink)."
                     /product="peptide transporter 5"
     gene            complement(65275..69924)
     mRNA            complement(<65275..>69924)
                     /product="hypothetical protein"
     gene            72292..74769
                     /gene_synonym="laccase 10"
                     /note="putative laccase, a member of laccase family of
                     genes (17 members in Arabidopsis)."
     mRNA            join(72292..72481,72617..72768,72859..73103,73194..73322,
                     /gene_synonym="laccase 10"
                     /product="laccase 10"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:BT014855.1"
     mRNA            join(72292..72481,72659..72768,72859..73103,73194..73322,
                     /gene_synonym="laccase 10"
                     /product="laccase 10"
     CDS             join(72392..72481,72617..72768,72859..73103,73194..73322,
                     /gene_synonym="laccase 10"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:BT014855.1"
                     /note="laccase 10 (LAC10); FUNCTIONS IN: laccase activity;
                     INVOLVED IN: oxidation reduction, lignin catabolic
                     process; LOCATED IN: endomembrane system, apoplast;
                     EXPRESSED IN: 9 plant structures; EXPRESSED DURING: petal
                     differentiation and expansion stage; CONTAINS InterPro
                     DOMAIN/s: Multicopper oxidase, type 3
                     (InterPro:IPR011707), Laccase (InterPro:IPR017761),
                     Multicopper oxidase, type 2 (InterPro:IPR011706),
                     Cupredoxin (InterPro:IPR008972), Multicopper oxidase,
                     copper-binding site (InterPro:IPR002355), Multicopper
                     oxidase, type 1 (InterPro:IPR001117); BEST Arabidopsis
                     thaliana protein match is: Laccase/Diphenol oxidase family
                     protein (TAIR:AT2G38080.1); Has 9531 Blast hits to 8327
                     proteins in 1383 species: Archae - 24; Bacteria - 3756;
                     Metazoa - 439; Fungi - 3375; Plants - 1571; Viruses - 0;
                     Other Eukaryotes - 366 (source: NCBI BLink)."
                     /product="laccase 10"
     CDS             join(72392..72481,72659..72768,72859..73103,73194..73322,
                     /gene_synonym="laccase 10"
                     /product="laccase 10"
     gene            76872..78543
     mRNA            join(76872..77576,77952..78543)
                     /product="Duplicated homeodomain-like superfamily protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AY519530.1"
     CDS             join(77116..77576,77952..78294)
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AY519530.1"
                     /note="Duplicated homeodomain-like superfamily protein;
                     CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat
                     shock protein, Hsp40, DnaJ (InterPro:IPR015609), SANT,
                     eukarya (InterPro:IPR017884), Myb-like DNA-binding domain,
                     SHAQKYF class (InterPro:IPR006447), SANT, DNA-binding
                     (InterPro:IPR001005), Myb, DNA-binding
                     (InterPro:IPR014778), Homeodomain-like
                     (InterPro:IPR009057), HTH transcriptional regulator,
                     Myb-type, DNA-binding (InterPro:IPR017930); BEST
                     Arabidopsis thaliana protein match is: Duplicated
                     homeodomain-like superfamily protein (TAIR:AT2G38090.1);
                     Has 1807 Blast hits to 1807 proteins in 277 species:
                     Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347;
                     Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source:
                     NCBI BLink)."
                     /product="Duplicated homeodomain-like superfamily protein"
     gene            complement(84466..86258)
                     /note="Natural antisense transcript overlaps with
                     Potential natural antisense gene, locus overlaps with
     ncRNA           complement(join(84466..85261,85357..86258))
                     /product="other RNA"
     ncRNA           complement(84466..86258)
                     /product="other RNA"
     gene            84474..86275
     mRNA            84474..86275
                     /product="HXXXD-type acyl-transferase family protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             84554..85981
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="HXXXD-type acyl-transferase family protein;
                     FUNCTIONS IN: transferase activity, transferring acyl
                     groups other than amino-acyl groups, transferase activity;
                     INVOLVED IN: biological_process unknown; LOCATED IN:
                     cellular_component unknown; EXPRESSED IN: 22 plant
                     structures; EXPRESSED DURING: 13 growth stages; CONTAINS
                     InterPro DOMAIN/s: Transferase (InterPro:IPR003480); BEST
                     Arabidopsis thaliana protein match is: HXXXD-type
                     acyl-transferase family protein (TAIR:AT2G39980.1); Has
                     1807 Blast hits to 1807 proteins in 277 species: Archae -
                     0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385;
                     Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink)."
                     /product="HXXXD-type acyl-transferase family protein"
     gene            complement(86543..90117)
                     /gene_synonym="SULFOLIPID SYNTHASE"
                     /gene_synonym="sulfoquinovosyldiacylglycerol 2"
                     /note="involved in sulfolipid biosynthesis"
     mRNA            complement(join(86543..87182,87268..87630,87724..87780,
                     /gene_synonym="SULFOLIPID SYNTHASE"
                     /gene_synonym="sulfoquinovosyldiacylglycerol 2"
                     /product="sulfoquinovosyldiacylglycerol 2"
     mRNA            complement(join(86548..87182,87414..87630,87724..87780,
                     /gene_synonym="SULFOLIPID SYNTHASE"
                     /gene_synonym="sulfoquinovosyldiacylglycerol 2"
                     /product="sulfoquinovosyldiacylglycerol 2"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             complement(join(86907..87182,87414..87630,87724..87780,
                     /gene_synonym="SULFOLIPID SYNTHASE"
                     /gene_synonym="sulfoquinovosyldiacylglycerol 2"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="sulfoquinovosyldiacylglycerol 2 (SQD2); FUNCTIONS
                     IN: UDP-glycosyltransferase activity,
                     UDP-sulfoquinovose:DAG sulfoquinovosyltransferase
                     activity, transferase activity, transferring glycosyl
                     groups; INVOLVED IN: cellular response to phosphate
                     starvation, sulfolipid biosynthetic process, glycolipid
                     biosynthetic process; LOCATED IN: chloroplast, chloroplast
                     envelope; EXPRESSED IN: 22 plant structures; EXPRESSED
                     DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s:
                     Glycosyl transferase, group 1 (InterPro:IPR001296); BEST
                     Arabidopsis thaliana protein match is:
                     UDP-Glycosyltransferase superfamily protein
                     (TAIR:AT5G59070.1); Has 35941 Blast hits to 35876 proteins
                     in 3155 species: Archae - 1250; Bacteria - 26211; Metazoa
                     - 142; Fungi - 236; Plants - 1690; Viruses - 2; Other
                     Eukaryotes - 6410 (source: NCBI BLink)."
                     /product="sulfoquinovosyldiacylglycerol 2"
     CDS             complement(join(87369..87630,87724..87780,87858..87935,
                     /gene_synonym="SULFOLIPID SYNTHASE"
                     /gene_synonym="sulfoquinovosyldiacylglycerol 2"
                     /product="sulfoquinovosyldiacylglycerol 2"
     gene            91786..92438
     mRNA            91786..92438
                     /product="josephin-like protein"
     gene            complement(91838..95701)
     mRNA            complement(join(91838..93009,93289..93396,93521..93584,
                     methyltransferases superfamily protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AY050853.1"
     CDS             91920..92324
                     /note="unknown protein; BEST Arabidopsis thaliana protein
                     match is: unknown protein (TAIR:AT3G09032.1); Has 30201
                     Blast hits to 17322 proteins in 780 species: Archae - 12;
                     Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants -
                     5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI
                     /product="josephin-like protein"
     mRNA            complement(join(92601..93009,93289..93396,93521..93584,
                     methyltransferases superfamily protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:BT002330.1"
     CDS             complement(join(92789..93009,93289..93396,93521..93584,
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:BT002330.1"
                     methyltransferases superfamily protein; FUNCTIONS IN:
                     methyltransferase activity, nucleic acid binding; INVOLVED
                     IN: methylation, rRNA methylation; LOCATED IN:
                     cellular_component unknown; EXPRESSED IN: 23 plant
                     structures; EXPRESSED DURING: 13 growth stages; CONTAINS
                     InterPro DOMAIN/s: Ribosomal RNA methyltransferase J
                     (InterPro:IPR015507), Ribosomal RNA methyltransferase
                     RrmJ/FtsJ (InterPro:IPR002877); BEST Arabidopsis thaliana
                     protein match is: FtsJ-like methyltransferase family
                     protein (TAIR:AT4G25730.1); Has 5711 Blast hits to 5669
                     proteins in 1418 species: Archae - 154; Bacteria - 2315;
                     Metazoa - 596; Fungi - 413; Plants - 124; Viruses - 65;
                     Other Eukaryotes - 2044 (source: NCBI BLink)."
                     methyltransferases superfamily protein"
     CDS             complement(join(94694..94708,94948..94997,95155..95248,
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AY050853.1"
                     methyltransferases superfamily protein; FUNCTIONS IN:
                     methyltransferase activity, nucleic acid binding; INVOLVED
                     IN: methylation, rRNA methylation; LOCATED IN:
                     cellular_component unknown; EXPRESSED IN: 23 plant
                     structures; EXPRESSED DURING: 13 growth stages; CONTAINS
                     InterPro DOMAIN/s: Ribosomal RNA methyltransferase J
                     (InterPro:IPR015507), Ribosomal RNA methyltransferase
                     RrmJ/FtsJ (InterPro:IPR002877); BEST Arabidopsis thaliana
                     protein match is: FtsJ-like methyltransferase family
                     protein (TAIR:AT4G25730.1); Has 30201 Blast hits to 17322
                     proteins in 780 species: Archae - 12; Bacteria - 1396;
                     Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0;
                     Other Eukaryotes - 2996 (source: NCBI BLink)."
                     methyltransferases superfamily protein"
     gene            complement(97161..97436)
     ncRNA           complement(97161..97436)
                     /product="other RNA"
     gene            97536..101835
                     /gene_synonym="like AUXIN RESISTANT 1"
                     /note="Encodes LAX1 (LIKE AUXIN RESISTANT), a member of
                     the AUX1 LAX family of auxin influx carriers. Required for
                     the establishment of embryonic root cell organization."
     mRNA            join(97536..98088,98215..98419,98615..98803,98931..99043,
                     /gene_synonym="like AUXIN RESISTANT 1"
                     /product="like AUXIN RESISTANT 1"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             join(98228..98419,98615..98803,98931..99043,99176..99359,
                     /gene_synonym="like AUXIN RESISTANT 1"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="like AUXIN RESISTANT 1 (LAX1); CONTAINS InterPro
                     DOMAIN/s: Amino acid transporter, transmembrane
                     (InterPro:IPR013057); BEST Arabidopsis thaliana protein
                     match is: Transmembrane amino acid transporter family
                     protein (TAIR:AT2G38120.1); Has 1807 Blast hits to 1807
                     proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa
                     - 736; Fungi - 347; Plants - 385; Viruses - 0; Other
                     Eukaryotes - 339 (source: NCBI BLink)."
                     /product="like AUXIN RESISTANT 1"
     mRNA            join(98533..98803,98931..99043,99176..99359,99441..99538,
                     /gene_synonym="like AUXIN RESISTANT 1"
                     /product="like AUXIN RESISTANT 1"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             join(98663..98803,98931..99043,99176..99359,99441..99538,
                     /gene_synonym="like AUXIN RESISTANT 1"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="like AUXIN RESISTANT 1 (LAX1); FUNCTIONS IN:
                     transporter activity; INVOLVED IN: amino acid transport,
                     root cap development; LOCATED IN: endomembrane system,
                     membrane; EXPRESSED IN: 20 plant structures; EXPRESSED
                     DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s:
                     Amino acid transporter, transmembrane
                     (InterPro:IPR013057); BEST Arabidopsis thaliana protein
                     match is: Transmembrane amino acid transporter family
                     protein (TAIR:AT2G38120.1); Has 35333 Blast hits to 34131
                     proteins in 2444 species: Archae - 798; Bacteria - 22429;
                     Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0;
                     Other Eukaryotes - 9610 (source: NCBI BLink)."
                     /product="like AUXIN RESISTANT 1"
     gene            complement(102176..103770)
     mRNA            complement(102176..103770)
                     /product="alpha 1,4-glycosyltransferase family protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             complement(102370..103593)
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="alpha 1,4-glycosyltransferase family protein;
                     FUNCTIONS IN: transferase activity, transferring glycosyl
                     groups, transferase activity; INVOLVED IN:
                     biological_process unknown; LOCATED IN: Golgi stack;
                     CONTAINS InterPro DOMAIN/s: Alpha 1,4-glycosyltransferase
                     conserved region (InterPro:IPR007652),
                     Glycosyltransferase, DXD sugar-binding region
                     (InterPro:IPR007577); BEST Arabidopsis thaliana protein
                     match is: alpha 1,4-glycosyltransferase family protein
                     (TAIR:AT3G09020.1); Has 1807 Blast hits to 1807 proteins
                     in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736;
                     Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes -
                     339 (source: NCBI BLink)."
                     /product="alpha 1,4-glycosyltransferase family protein"
     gene            105268..107454
     mRNA            join(105268..105582,105697..105888,105976..106476,
                     /product="Carbohydrate-binding-like fold"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     mRNA            join(105268..105582,105697..105888,105976..106453,
                     /product="Carbohydrate-binding-like fold"
     mRNA            join(105282..105582,105697..105888,105976..107405)
                     /product="Carbohydrate-binding-like fold"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:BX830930.1"
     CDS             join(105367..105582,105697..105888,105976..106476,
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:BX830930.1"
                     /note="Carbohydrate-binding-like fold; FUNCTIONS IN:
                     carbohydrate binding, catalytic activity; INVOLVED IN:
                     carbohydrate metabolic process; LOCATED IN:
                     cellular_component unknown; EXPRESSED IN: 21 plant
                     structures; EXPRESSED DURING: 13 growth stages; CONTAINS
                     InterPro DOMAIN/s: Immunoglobulin-like fold
                     (InterPro:IPR013783), Carbohydrate-binding-like fold
                     (InterPro:IPR013784), Glycoside hydrolase,
                     carbohydrate-binding (InterPro:IPR002044); BEST
                     Arabidopsis thaliana protein match is:
                     catalytics;carbohydrate kinases;phosphoglucan, water
                     dikinases (TAIR:AT5G26570.1); Has 35333 Blast hits to
                     34131 proteins in 2444 species: Archae - 798; Bacteria -
                     22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses -
                     0; Other Eukaryotes - 9610 (source: NCBI BLink)."
                     /product="Carbohydrate-binding-like fold"
     CDS             join(105367..105582,105697..105888,105976..106453,
                     /product="Carbohydrate-binding-like fold"
     CDS             join(105367..105582,105697..105888,105976..106488)
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="Carbohydrate-binding-like fold; FUNCTIONS IN:
                     carbohydrate binding, catalytic activity; INVOLVED IN:
                     carbohydrate metabolic process; LOCATED IN:
                     cellular_component unknown; EXPRESSED IN: 21 plant
                     structures; EXPRESSED DURING: 13 growth stages; CONTAINS
                     InterPro DOMAIN/s: Immunoglobulin-like fold
                     (InterPro:IPR013783), Carbohydrate-binding-like fold
                     (InterPro:IPR013784), Glycoside hydrolase,
                     carbohydrate-binding (InterPro:IPR002044); BEST
                     Arabidopsis thaliana protein match is:
                     catalytics;carbohydrate kinases;phosphoglucan, water
                     dikinases (TAIR:AT5G26570.1); Has 30201 Blast hits to
                     17322 proteins in 780 species: Archae - 12; Bacteria -
                     1396; Metazoa - 17338; Fungi - 3422; Plants - 5037;
                     Viruses - 0; Other Eukaryotes - 2996 (source: NCBI
                     /product="Carbohydrate-binding-like fold"
     gene            complement(107547..112324)
                     /gene_synonym="carboxyl-terminal domain (ctd)
                     phosphatase-like 2"
                     /note="Encodes CPL2, a carboxyl-terminal domain (CTD)
                     phosphatase that dephosphorylates CTD Ser5-PO4 of the RNA
                     polymerase II complex. Regulates plant growth, stress and
                     auxin responses."
     mRNA            complement(join(107547..108311,108451..108547,
                     /gene_synonym="carboxyl-terminal domain (ctd)
                     phosphatase-like 2"
                     /product="carboxyl-terminal domain (ctd) phosphatase-like
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AK221220.1"
     mRNA            complement(join(107646..107958,108167..108311,
                     /gene_synonym="carboxyl-terminal domain (ctd)
                     phosphatase-like 2"
                     /product="carboxyl-terminal domain (ctd) phosphatase-like
     CDS             complement(join(107943..107958,108167..108311,
                     /gene_synonym="carboxyl-terminal domain (ctd)
                     phosphatase-like 2"
                     /note="carboxyl-terminal domain (ctd) phosphatase-like 2
                     (CPL2); FUNCTIONS IN: double-stranded RNA binding,
                     phosphatase activity; INVOLVED IN: response to auxin
                     stimulus, response to osmotic stress, developmental
                     growth; LOCATED IN: intracellular; EXPRESSED IN: 25 plant
                     structures; EXPRESSED DURING: 14 growth stages; CONTAINS
                     InterPro DOMAIN/s: Double-stranded RNA-binding
                     (InterPro:IPR001159), Double-stranded RNA-binding-like
                     (InterPro:IPR014720), NLI interacting factor
                     (InterPro:IPR004274); BEST Arabidopsis thaliana protein
                     match is: C-terminal domain phosphatase-like 1
                     /product="carboxyl-terminal domain (ctd) phosphatase-like
     CDS             complement(join(108163..108311,108451..108547,
                     /gene_synonym="carboxyl-terminal domain (ctd)
                     phosphatase-like 2"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AK221220.1"
                     /note="carboxyl-terminal domain (ctd) phosphatase-like 2
                     (CPL2); FUNCTIONS IN: double-stranded RNA binding,
                     phosphatase activity; INVOLVED IN: response to auxin
                     stimulus, response to osmotic stress, developmental
                     growth; LOCATED IN: intracellular; EXPRESSED IN: 25 plant
                     structures; EXPRESSED DURING: 14 growth stages; CONTAINS
                     InterPro DOMAIN/s: Double-stranded RNA-binding
                     (InterPro:IPR001159), Double-stranded RNA-binding-like
                     (InterPro:IPR014720), NLI interacting factor
                     (InterPro:IPR004274); BEST Arabidopsis thaliana protein
                     match is: C-terminal domain phosphatase-like 1
                     (TAIR:AT4G21670.1); Has 234 Blast hits to 223 proteins in
                     82 species: Archae - 0; Bacteria - 8; Metazoa - 40; Fungi
                     - 61; Plants - 110; Viruses - 0; Other Eukaryotes - 15
                     (source: NCBI BLink)."
                     /product="carboxyl-terminal domain (ctd) phosphatase-like
     gene            complement(113921..116411)
                     /gene_synonym="BASIC PROLINE-RICH PROTEIN3"
                     /note="Encodes a microtubule-associated protein."
     mRNA            complement(join(113921..114373,114465..115487,
                     /gene_synonym="BASIC PROLINE-RICH PROTEIN3"
                     /product="GPI-anchored protein"
     mRNA            complement(join(113921..115487,115604..115691,
                     /gene_synonym="BASIC PROLINE-RICH PROTEIN3"
                     /product="GPI-anchored protein"
     mRNA            complement(join(113999..114373,114465..115487,
                     /gene_synonym="BASIC PROLINE-RICH PROTEIN3"
                     /product="GPI-anchored protein"
                     /inference="Similar to RNA sequence, EST:INSD:T12964.1"
     CDS             complement(join(114185..114373,114465..115487,
                     /gene_synonym="BASIC PROLINE-RICH PROTEIN3"
                     /inference="Similar to RNA sequence, EST:INSD:T12964.1"
                     /note="BEST Arabidopsis thaliana protein match is:
                     proline-rich family protein (TAIR:AT3G09000.1); Has 1807
                     Blast hits to 1807 proteins in 277 species: Archae - 0;
                     Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385;
                     Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink)."
                     /product="GPI-anchored protein"
     CDS             complement(join(114185..114373,114465..115487,
                     /gene_synonym="BASIC PROLINE-RICH PROTEIN3"
                     /product="GPI-anchored protein"
     CDS             complement(join(114456..115487,115604..115691,
                     /gene_synonym="BASIC PROLINE-RICH PROTEIN3"
                     /product="GPI-anchored protein"
     gene            117297..121569
     mRNA            join(117297..117618,117742..117859,117933..118084,
                     /product="mRNA capping enzyme family protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             join(117520..117618,117742..117859,117933..118084,
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="mRNA capping enzyme family protein; FUNCTIONS IN:
                     phosphatase activity, protein tyrosine phosphatase
                     activity, protein tyrosine/serine/threonine phosphatase
                     activity, mRNA guanylyltransferase activity,
                     polynucleotide 5'-phosphatase activity; INVOLVED IN:
                     protein amino acid dephosphorylation, mRNA processing,
                     mRNA capping, dephosphorylation; LOCATED IN: nucleus;
                     EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15
                     growth stages; CONTAINS InterPro DOMAIN/s: Nucleic
                     acid-binding, OB-fold (InterPro:IPR012340),
                     Dual-specific/protein-tyrosine phosphatase, conserved
                     region (InterPro:IPR000387), mRNA capping enzyme
                     (InterPro:IPR001339), mRNA capping enzyme, bifunctional
                     (InterPro:IPR017074), Protein-tyrosine phosphatase, active
                     site (InterPro:IPR016130), Nucleic acid-binding,
                     OB-fold-like (InterPro:IPR016027), Dual specificity
                     phosphatase, catalytic domain (InterPro:IPR000340), mRNA
                     capping enzyme, C-terminal (InterPro:IPR013846); BEST
                     Arabidopsis thaliana protein match is: mRNA capping enzyme
                     family protein (TAIR:AT3G09100.2); Has 888 Blast hits to
                     860 proteins in 246 species: Archae - 0; Bacteria - 2;
                     Metazoa - 276; Fungi - 241; Plants - 79; Viruses - 71;
                     Other Eukaryotes - 219 (source: NCBI BLink)."
                     /product="mRNA capping enzyme family protein"
     gene            complement(121483..122525)
     mRNA            complement(join(121483..121717,121817..122111,
                     /product="PEBP (phosphatidylethanolamine-binding protein)
                     family protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     mRNA            complement(join(121537..121717,121817..122507))
                     /product="PEBP (phosphatidylethanolamine-binding protein)
                     family protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:BX833298.1"
     CDS             complement(join(121643..121717,121817..122111,
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="PEBP (phosphatidylethanolamine-binding protein)
                     family protein; FUNCTIONS IN: phosphatidylethanolamine
                     binding; INVOLVED IN: biological_process unknown; LOCATED
                     IN: cellular_component unknown; EXPRESSED IN: 7 plant
                     structures; EXPRESSED DURING: LP.04 four leaves visible, 4
                     anthesis, 4 leaf senescence stage, petal differentiation
                     and expansion stage, LP.08 eight leaves visible; CONTAINS
                     InterPro DOMAIN/s: YbhB/YbcL (InterPro:IPR005247),
                     Phosphatidylethanolamine-binding protein PEBP
                     (InterPro:IPR008914); Has 1807 Blast hits to 1807 proteins
                     in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736;
                     Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes -
                     339 (source: NCBI BLink)."
                     /product="PEBP (phosphatidylethanolamine-binding protein)
                     family protein"
     CDS             complement(join(121643..121717,121817..122128))
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:BX833298.1"
                     /note="PEBP (phosphatidylethanolamine-binding protein)
                     family protein; FUNCTIONS IN: phosphatidylethanolamine
                     binding; INVOLVED IN: biological_process unknown; LOCATED
                     IN: cellular_component unknown; EXPRESSED IN: 7 plant
                     structures; EXPRESSED DURING: LP.04 four leaves visible, 4
                     anthesis, 4 leaf senescence stage, petal differentiation
                     and expansion stage, LP.08 eight leaves visible; CONTAINS
                     InterPro DOMAIN/s: YbhB/YbcL (InterPro:IPR005247),
                     Phosphatidylethanolamine-binding protein PEBP
                     (InterPro:IPR008914); Has 30201 Blast hits to 17322
                     proteins in 780 species: Archae - 12; Bacteria - 1396;
                     Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0;
                     Other Eukaryotes - 2996 (source: NCBI BLink)."
                     /product="PEBP (phosphatidylethanolamine-binding protein)
                     family protein"
     mRNA            complement(join(121729..121737,121817..122111,
                     /product="PEBP (phosphatidylethanolamine-binding protein)
                     family protein"
     CDS             complement(join(121729..121737,121817..122111,
                     /product="PEBP (phosphatidylethanolamine-binding protein)
                     family protein"
     gene            125304..125819
     mRNA            125304..125819
                     /product="transcription factor bHLH140-like protein"
     CDS             125304..125819
                     /product="transcription factor bHLH140-like protein"
     gene            126204..129150
                     /note="Encodes a protein that has adenylylsulfate
                     sulfohydrolase activity (E.C. in vitro. This
                     locus has been split into two based on data presented in
                     PMID:22372440. The first annotated exon of the existing
                     AT5G01310.1 model (TAIR10) with part of the first intron
                     becomes a new locus AT5G01305 (encodes a bHLH proteins
                     ROX1). The 3' part retains the original locus name:
                     AT5G01310 (encodes APTX)."
     mRNA            join(126204..126502,126668..127539,127617..128214,
                     /product="APRATAXIN-like protein"
                     /inference="Similar to RNA sequence,
     CDS             join(126329..126502,126668..127539,127617..128214,
                     /inference="Similar to RNA sequence,
                     /note="APRATAXIN-like (APTX); FUNCTIONS IN:
                     adenylylsulfatase activity, sequence-specific DNA binding
                     transcription factor activity; INVOLVED IN: sulfur
                     metabolic process, purine ribonucleotide metabolic
                     process, regulation of transcription; LOCATED IN:
                     intracellular, nucleus, chloroplast; EXPRESSED IN: 11
                     plant structures; EXPRESSED DURING: 4 anthesis, C globular
                     stage, petal differentiation and expansion stage, E
                     expanded cotyledon stage, D bilateral stage; CONTAINS
                     InterPro DOMAIN/s: Zinc finger, C2H2-like
                     (InterPro:IPR015880), Appr-1-p processing
                     (InterPro:IPR002589), Histidine triad (HIT) protein
                     (InterPro:IPR001310), Helix-loop-helix DNA-binding domain
                     (InterPro:IPR001092), Histidine triad motif
                     (InterPro:IPR011151), Helix-loop-helix DNA-binding
                     (InterPro:IPR011598), Histidine triad-like motif
                     (InterPro:IPR011146), Histidine triad, conserved site
                     (InterPro:IPR019808); BEST Arabidopsis thaliana protein
                     match is: basic helix-loop-helix (bHLH) DNA-binding
                     superfamily protein (TAIR:AT3G21330.1); Has 1807 Blast
                     hits to 1807 proteins in 277 species: Archae - 0; Bacteria
                     - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses -
                     0; Other Eukaryotes - 339 (source: NCBI BLink)."
                     /product="APRATAXIN-like protein"
     gene            complement(129263..131687)
     mRNA            complement(join(129263..129654,129722..130028,
                     /product="Thiamine pyrophosphate dependent pyruvate
                     decarboxylase family protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:BT004248.1"
     CDS             complement(join(129484..129654,129722..130028,
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:BT004248.1"
                     /note="Thiamine pyrophosphate dependent pyruvate
                     decarboxylase family protein; FUNCTIONS IN: in 6
                     functions; LOCATED IN: cellular_component unknown;
                     CONTAINS InterPro DOMAIN/s: TPP-binding enzyme, conserved
                     site (InterPro:IPR000399), Thiamine pyrophosphate enzyme,
                     central domain (InterPro:IPR012000), Pyruvate
                     decarboxylase/indolepyruvate decarboxylase
                     (InterPro:IPR012110), Thiamine pyrophosphate enzyme,
                     N-terminal TPP-binding domain (InterPro:IPR012001),
                     Thiamine pyrophosphate enzyme, C-terminal TPP-binding
                     (InterPro:IPR011766); BEST Arabidopsis thaliana protein
                     match is: Thiamine pyrophosphate dependent pyruvate
                     decarboxylase family protein (TAIR:AT4G33070.1); Has 1807
                     Blast hits to 1807 proteins in 277 species: Archae - 0;
                     Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385;
                     Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink)."
                     /product="Thiamine pyrophosphate dependent pyruvate
                     decarboxylase family protein"
     gene            complement(132264..134920)
                     /gene_synonym="pyruvate decarboxylase-3"
                     /gene_synonym="PYRUVATE DECARBOXYLASE-3"
                     /note="pyruvate decarboxylase"
     mRNA            complement(join(132264..132708,132790..133096,
                     /gene_synonym="pyruvate decarboxylase-3"
                     /gene_synonym="PYRUVATE DECARBOXYLASE-3"
                     /product="pyruvate decarboxylase-3"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             complement(join(132538..132708,132790..133096,
                     /gene_synonym="pyruvate decarboxylase-3"
                     /gene_synonym="PYRUVATE DECARBOXYLASE-3"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="pyruvate decarboxylase-3 (PDC3); FUNCTIONS IN: in 6
                     functions; CONTAINS InterPro DOMAIN/s: TPP-binding enzyme,
                     conserved site (InterPro:IPR000399), Thiamine
                     pyrophosphate enzyme, central domain (InterPro:IPR012000),
                     Pyruvate decarboxylase/indolepyruvate decarboxylase
                     (InterPro:IPR012110), Thiamine pyrophosphate enzyme,
                     N-terminal TPP-binding domain (InterPro:IPR012001),
                     Thiamine pyrophosphate enzyme, C-terminal TPP-binding
                     (InterPro:IPR011766); BEST Arabidopsis thaliana protein
                     match is: Thiamine pyrophosphate dependent pyruvate
                     decarboxylase family protein (TAIR:AT5G01320.1); Has 1807
                     Blast hits to 1807 proteins in 277 species: Archae - 0;
                     Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385;
                     Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink)."
                     /product="pyruvate decarboxylase-3"
     gene            135831..141287
     mRNA            <135831..>141287
                     /product="hypothetical protein"
     gene            complement(142346..142489)
     ncRNA           complement(142346..142489)
                     /product="other RNA"
     gene            complement(142551..142633)
     ncRNA           complement(142551..142633)
                     /product="other RNA"
     gene            complement(143055..144863)
                     /gene_synonym="mitochondrial succinate-fumarate carrier 1"
     mRNA            complement(join(143055..143779,144172..144863))
                     /gene_synonym="mitochondrial succinate-fumarate carrier 1"
                     /product="Mitochondrial substrate carrier family protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             complement(join(143240..143779,144172..144561))
                     /gene_synonym="mitochondrial succinate-fumarate carrier 1"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="Mitochondrial substrate carrier family protein;
                     FUNCTIONS IN: transporter activity, binding; INVOLVED IN:
                     transport, mitochondrial transport, transmembrane
                     transport; LOCATED IN: mitochondrial inner membrane,
                     membrane; EXPRESSED IN: 23 plant structures; EXPRESSED
                     DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s:
                     Mitochondrial substrate carrier (InterPro:IPR001993),
                     Mitochondrial substrate/solute carrier
                     (InterPro:IPR018108), Adenine nucleotide translocator 1
                     (InterPro:IPR002113); BEST Arabidopsis thaliana protein
                     match is: Mitochondrial substrate carrier family protein
                     (TAIR:AT2G37890.1); Has 1807 Blast hits to 1807 proteins
                     in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736;
                     Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes -
                     339 (source: NCBI BLink)."
                     /product="Mitochondrial substrate carrier family protein"
     gene            complement(145387..147356)
     mRNA            complement(join(145387..145882,145970..146028,
                     /product="UvrABC system C protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             complement(join(145865..145882,145970..146028,
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="unknown protein; FUNCTIONS IN: molecular_function
                     unknown; INVOLVED IN: biological_process unknown; LOCATED
                     IN: endomembrane system; EXPRESSED IN: 24 plant
                     structures; EXPRESSED DURING: 15 growth stages; Has 30201
                     Blast hits to 17322 proteins in 780 species: Archae - 12;
                     Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants -
                     5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI
                     /product="UvrABC system C protein"
     gene            complement(146303..146377)
     ncRNA           complement(146303..146377)
                     /product="other RNA"
     gene            complement(146623..146741)
     ncRNA           complement(146623..146741)
                     /product="other RNA"
     gene            complement(147416..149495)
                     /gene_synonym="TRICHOME BIREFRINGENCE-LIKE 3"
                     /note="Encodes a member of the TBL (TRICHOME
                     BIREFRINGENCE-LIKE) gene family containing a
                     plant-specific DUF231 (domain of unknown function) domain.
                     TBL gene family has 46 members, two of which
                     (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be
                     involved in the synthesis and deposition of secondary wall
                     cellulose, presumably by influencing the esterification
                     state of pectic polymers. A nomenclature for this gene
                     family has been proposed (Volker Bischoff & Wolf Scheible,
                     2010, personal communication)."
     mRNA            complement(join(147416..147941,148018..148376,
                     /gene_synonym="TRICHOME BIREFRINGENCE-LIKE 3"
                     /product="trichome birefringence-like protein (DUF828)"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     mRNA            complement(join(147417..147941,148018..148376,
                     /gene_synonym="TRICHOME BIREFRINGENCE-LIKE 3"
                     /product="trichome birefringence-like protein (DUF828)"
                     /inference="Similar to RNA sequence,
     CDS             complement(join(147608..147941,148018..148376,
                     /gene_synonym="TRICHOME BIREFRINGENCE-LIKE 3"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="TRICHOME BIREFRINGENCE-LIKE 3 (TBL3); CONTAINS
                     InterPro DOMAIN/s: Protein of unknown function DUF231,
                     plant (InterPro:IPR004253); BEST Arabidopsis thaliana
                     protein match is: Plant protein of unknown function
                     (DUF828) (TAIR:AT3G55990.1); Has 30201 Blast hits to 17322
                     proteins in 780 species: Archae - 12; Bacteria - 1396;
                     Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0;
                     Other Eukaryotes - 2996 (source: NCBI BLink)."
                     /product="trichome birefringence-like protein (DUF828)"
     CDS             complement(join(147608..147941,148018..148376,
                     /gene_synonym="TRICHOME BIREFRINGENCE-LIKE 3"
                     /inference="Similar to RNA sequence,
                     /note="TRICHOME BIREFRINGENCE-LIKE 3 (TBL3); CONTAINS
                     InterPro DOMAIN/s: Protein of unknown function DUF231,
                     plant (InterPro:IPR004253); BEST Arabidopsis thaliana
                     protein match is: Plant protein of unknown function
                     (DUF828) (TAIR:AT3G55990.1); Has 1290 Blast hits to 1278
                     proteins in 29 species: Archae - 0; Bacteria - 0; Metazoa
                     - 3; Fungi - 2; Plants - 1285; Viruses - 0; Other
                     Eukaryotes - 0 (source: NCBI BLink)."
                     /product="trichome birefringence-like protein (DUF828)"
     gene            complement(150355..150427)
     tRNA            complement(150355..150427)
                     /note="pre-tRNA-tRNA-Ala (anticodon: AGC)"
     gene            152446..154467
                     /gene_synonym="ALC-interacting protein 1"
                     /gene_synonym="TON1 Recruiting Motif 29"
                     /note="Nuclear protein with a lysine-rich domain and a
                     C-terminal serine-rich domain. Interacts with Alcatraz
                     (ALC). ACI1 is mainly expressed in the vascular system.
                     Involved in cell separation during fruit dehiscence."
     mRNA            join(152446..153523,153961..154467)
                     /gene_synonym="ALC-interacting protein 1"
                     /gene_synonym="TON1 Recruiting Motif 29"
                     /product="ALC-interacting protein 1"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             join(152575..153523,153961..154295)
                     /gene_synonym="ALC-interacting protein 1"
                     /gene_synonym="TON1 Recruiting Motif 29"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="ALC-interacting protein 1 (ACI1); Has 1807 Blast
                     hits to 1807 proteins in 277 species: Archae - 0; Bacteria
                     - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses -
                     0; Other Eukaryotes - 339 (source: NCBI BLink)."
                     /product="ALC-interacting protein 1"
     gene            complement(155610..157601)
     mRNA            complement(join(155610..156419,157116..157601))
                     /product="Homeodomain-like superfamily protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             complement(join(155784..156419,157116..157451))
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="Homeodomain-like superfamily protein; CONTAINS
                     InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005),
                     MYB-like (InterPro:IPR017877); BEST Arabidopsis thaliana
                     protein match is: Homeodomain-like superfamily protein
                     (TAIR:AT2G38250.1); Has 1807 Blast hits to 1807 proteins
                     in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736;
                     Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes -
                     339 (source: NCBI BLink)."
                     /product="Homeodomain-like superfamily protein"
     gene            complement(160158..162354)
     mRNA            complement(join(160158..160938,161546..161949,
                     /product="DNAJ heat shock family protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     mRNA            complement(join(160173..161949,162035..162354))
                     /product="DNAJ heat shock family protein"
                     /inference="Similar to RNA sequence,
     mRNA            complement(join(160264..160735,160853..160938,
                     /product="DNAJ heat shock family protein"
                     /inference="Similar to RNA sequence,
     mRNA            complement(join(160264..160938,161720..161949,
                     /product="DNAJ heat shock family protein"
                     /inference="Similar to RNA sequence,
     CDS             complement(join(160500..160735,160853..160938,
                     /inference="Similar to RNA sequence,
                     /note="DNAJ heat shock family protein; FUNCTIONS IN:
                     unfolded protein binding, heat shock protein binding;
                     INVOLVED IN: protein folding; LOCATED IN:
                     cellular_component unknown; EXPRESSED IN: 24 plant
                     structures; EXPRESSED DURING: 15 growth stages; CONTAINS
                     InterPro DOMAIN/s: Molecular chaperone, heat shock
                     protein, Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ
                     peptide-binding (InterPro:IPR008971), Chaperone DnaJ,
                     C-terminal (InterPro:IPR002939), Heat shock protein DnaJ,
                     N-terminal (InterPro:IPR001623), Heat shock protein DnaJ,
                     conserved site (InterPro:IPR018253); BEST Arabidopsis
                     thaliana protein match is: DNAJ heat shock family protein
                     (TAIR:AT3G08910.1); Has 27199 Blast hits to 26228 proteins
                     in 3366 species: Archae - 181; Bacteria - 10265; Metazoa -
                     4962; Fungi - 2544; Plants - 3099; Viruses - 15; Other
                     Eukaryotes - 6133 (source: NCBI BLink)."
                     /product="DNAJ heat shock family protein"
     CDS             complement(join(160500..160938,161720..161949,
                     /inference="Similar to RNA sequence,
                     /note="DNAJ heat shock family protein; FUNCTIONS IN:
                     unfolded protein binding, heat shock protein binding;
                     INVOLVED IN: protein folding; LOCATED IN:
                     cellular_component unknown; EXPRESSED IN: 24 plant
                     structures; EXPRESSED DURING: 15 growth stages; CONTAINS
                     InterPro DOMAIN/s: Molecular chaperone, heat shock
                     protein, Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ
                     peptide-binding (InterPro:IPR008971), Chaperone DnaJ,
                     C-terminal (InterPro:IPR002939), Heat shock protein DnaJ,
                     N-terminal (InterPro:IPR001623), Heat shock protein DnaJ
                     (InterPro:IPR003095), Heat shock protein DnaJ, conserved
                     site (InterPro:IPR018253); BEST Arabidopsis thaliana
                     protein match is: DNAJ heat shock family protein
                     (TAIR:AT3G08910.1); Has 30201 Blast hits to 17322 proteins
                     in 780 species: Archae - 12; Bacteria - 1396; Metazoa -
                     17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other
                     Eukaryotes - 2996 (source: NCBI BLink)."
                     /product="DNAJ heat shock family protein"
     CDS             complement(join(160500..160938,161546..161949,
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="DNAJ heat shock family protein; FUNCTIONS IN:
                     unfolded protein binding, heat shock protein binding;
                     INVOLVED IN: protein folding; LOCATED IN:
                     cellular_component unknown; EXPRESSED IN: 24 plant
                     structures; EXPRESSED DURING: 15 growth stages; CONTAINS
                     InterPro DOMAIN/s: Molecular chaperone, heat shock
                     protein, Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ
                     peptide-binding (InterPro:IPR008971), Chaperone DnaJ,
                     C-terminal (InterPro:IPR002939), Heat shock protein DnaJ,
                     N-terminal (InterPro:IPR001623), Heat shock protein DnaJ
                     (InterPro:IPR003095), Heat shock protein DnaJ, conserved
                     site (InterPro:IPR018253); BEST Arabidopsis thaliana
                     protein match is: DNAJ heat shock family protein
                     (TAIR:AT3G08910.1); Has 1807 Blast hits to 1807 proteins
                     in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736;
                     Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes -
                     339 (source: NCBI BLink)."
                     /product="DNAJ heat shock family protein"
     CDS             complement(join(161413..161949,162035..162199))
                     /inference="Similar to RNA sequence,
                     /note="DNAJ heat shock family protein; FUNCTIONS IN:
                     unfolded protein binding, heat shock protein binding;
                     INVOLVED IN: protein folding; LOCATED IN:
                     cellular_component unknown; EXPRESSED IN: 24 plant
                     structures; EXPRESSED DURING: 15 growth stages; CONTAINS
                     InterPro DOMAIN/s: Molecular chaperone, heat shock
                     protein, Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ
                     peptide-binding (InterPro:IPR008971), Chaperone DnaJ,
                     C-terminal (InterPro:IPR002939), Heat shock protein DnaJ,
                     N-terminal (InterPro:IPR001623), Heat shock protein DnaJ
                     (InterPro:IPR003095), Heat shock protein DnaJ, conserved
                     site (InterPro:IPR018253); BEST Arabidopsis thaliana
                     protein match is: DNAJ heat shock family protein
                     (TAIR:AT3G08910.1); Has 26610 Blast hits to 26386 proteins
                     in 3381 species: Archae - 182; Bacteria - 10306; Metazoa -
                     4695; Fungi - 2459; Plants - 2906; Viruses - 15; Other
                     Eukaryotes - 6047 (source: NCBI BLink)."
                     /product="DNAJ heat shock family protein"
     gene            complement(162522..171302)
                     /gene_synonym="ENHANCED SILENCING PHENOTYPE 4"
                     /note="Encodes a Symplekin/Pta1 homologue which would have
                     the potential to interact with either ESP1 or AtCstF64."
     mRNA            complement(join(162522..163505,163615..163718,
                     /gene_synonym="ENHANCED SILENCING PHENOTYPE 4"
                     /product="HEAT repeat-containing protein"
     mRNA            complement(join(162550..163505,163615..163718,
                     /gene_synonym="ENHANCED SILENCING PHENOTYPE 4"
                     /product="HEAT repeat-containing protein"
     mRNA            complement(join(162550..163505,163615..163718,
                     /gene_synonym="ENHANCED SILENCING PHENOTYPE 4"
                     /product="HEAT repeat-containing protein"
                     /inference="Similar to RNA sequence,
     CDS             complement(join(162803..163505,163615..163718,
                     /gene_synonym="ENHANCED SILENCING PHENOTYPE 4"
                     /product="HEAT repeat-containing protein"
     CDS             complement(join(162803..163505,163615..163718,
                     /gene_synonym="ENHANCED SILENCING PHENOTYPE 4"
                     /inference="Similar to RNA sequence,
                     /note="ENHANCED SILENCING PHENOTYPE 4 (ESP4); FUNCTIONS
                     IN: binding; INVOLVED IN: posttranscriptional gene
                     silencing by RNA, RNA processing; LOCATED IN: mRNA
                     cleavage and polyadenylation specificity factor complex;
                     EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13
                     growth stages; CONTAINS InterPro DOMAIN/s: Symplekin tight
                     junction protein C-terminal (InterPro:IPR022075),
                     Armadillo-type fold (InterPro:IPR016024), Protein of
                     unknown function DUF3453 (InterPro:IPR021850); BEST
                     Arabidopsis thaliana protein match is: unknown protein
                     (TAIR:AT1G27595.1); Has 1807 Blast hits to 1807 proteins
                     in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736;
                     Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes -
                     339 (source: NCBI BLink)."
                     /product="HEAT repeat-containing protein"
     CDS             complement(join(162803..163505,163615..163718,
                     /gene_synonym="ENHANCED SILENCING PHENOTYPE 4"
                     /product="HEAT repeat-containing protein"
     gene            complement(171889..173663)
                     /gene_synonym="ARABIDOPSIS THALIANA PYRIDOXINE
                     BIOSYNTHESIS 1.3"
                     /gene_synonym="PYRIDOXINE BIOSYNTHESIS 1.3"
                     /gene_synonym="REDUCED SUGAR RESPONSE 4"
                     /note="Encodes a protein predicted to function in tandem
                     with PDX2 to form glutamine amidotransferase complex with
                     involved in vitamin B6 biosynthesis."
     mRNA            complement(join(171889..172086,172561..173663))
                     /gene_synonym="ARABIDOPSIS THALIANA PYRIDOXINE
                     BIOSYNTHESIS 1.3"
                     /gene_synonym="PYRIDOXINE BIOSYNTHESIS 1.3"
                     /gene_synonym="REDUCED SUGAR RESPONSE 4"
                     /product="Aldolase-type TIM barrel family protein"
     mRNA            complement(171889..173663)
                     /gene_synonym="ARABIDOPSIS THALIANA PYRIDOXINE
                     BIOSYNTHESIS 1.3"
                     /gene_synonym="PYRIDOXINE BIOSYNTHESIS 1.3"
                     /gene_synonym="REDUCED SUGAR RESPONSE 4"
                     /product="Aldolase-type TIM barrel family protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             complement(172576..173505)
                     /gene_synonym="ARABIDOPSIS THALIANA PYRIDOXINE
                     BIOSYNTHESIS 1.3"
                     /gene_synonym="PYRIDOXINE BIOSYNTHESIS 1.3"
                     /gene_synonym="REDUCED SUGAR RESPONSE 4"
                     /product="Aldolase-type TIM barrel family protein"
     CDS             complement(172576..173505)
                     /gene_synonym="ARABIDOPSIS THALIANA PYRIDOXINE
                     BIOSYNTHESIS 1.3"
                     /gene_synonym="PYRIDOXINE BIOSYNTHESIS 1.3"
                     /gene_synonym="REDUCED SUGAR RESPONSE 4"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="REDUCED SUGAR RESPONSE 4 (RSR4); FUNCTIONS IN:
                     protein homodimerization activity, protein
                     heterodimerization activity; INVOLVED IN: in 12 processes;
                     LOCATED IN: cytosol, endomembrane system, plasma membrane;
                     EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15
                     growth stages; CONTAINS InterPro DOMAIN/s: Vitamin B6
                     biosynthesis protein (InterPro:IPR001852),
                     Ribulose-phosphate binding barrel (InterPro:IPR011060);
                     BEST Arabidopsis thaliana protein match is: pyridoxine
                     biosynthesis 1.1 (TAIR:AT2G38230.1); Has 1807 Blast hits
                     to 1807 proteins in 277 species: Archae - 0; Bacteria - 0;
                     Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0;
                     Other Eukaryotes - 339 (source: NCBI BLink)."
                     /product="Aldolase-type TIM barrel family protein"
     gene            complement(174779..176269)
     mRNA            complement(174779..176269)
                     /product="Glutaredoxin family protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             complement(174886..176091)
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="Glutaredoxin family protein; FUNCTIONS IN: electron
                     carrier activity, protein disulfide oxidoreductase
                     activity; INVOLVED IN: cell redox homeostasis; CONTAINS
                     InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335),
                     Glutaredoxin (InterPro:IPR002109), Thioredoxin-like fold
                     (InterPro:IPR012336); BEST Arabidopsis thaliana protein
                     match is: Glutaredoxin family protein (TAIR:AT5G06470.1);
                     Has 1807 Blast hits to 1807 proteins in 277 species:
                     Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347;
                     Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source:
                     NCBI BLink)."
                     /product="Glutaredoxin family protein"
     gene            complement(176388..178654)
     mRNA            complement(join(176388..176835,177094..177175,
                     /product="Got1/Sft2-like vescicle transport protein
     mRNA            complement(join(176447..176835,177094..177175,
                     /product="Got1/Sft2-like vescicle transport protein
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             complement(join(176797..176835,177094..177175,
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="Got1/Sft2-like vescicle transport protein family;
                     FUNCTIONS IN: molecular_function unknown; INVOLVED IN:
                     vesicle-mediated transport; LOCATED IN: cellular_component
                     unknown; CONTAINS InterPro DOMAIN/s: Vesicle transport
                     protein, Got1/SFT2-like (InterPro:IPR007305); BEST
                     Arabidopsis thaliana protein match is: Got1/Sft2-like
                     vescicle transport protein family (TAIR:AT3G49420.1); Has
                     1807 Blast hits to 1807 proteins in 277 species: Archae -
                     0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385;
                     Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink)."
                     /product="Got1/Sft2-like vescicle transport protein
     CDS             complement(join(176797..176835,177094..177175,
                     /note="Got1/Sft2-like vescicle transport protein family;
                     FUNCTIONS IN: molecular_function unknown; INVOLVED IN:
                     vesicle-mediated transport; LOCATED IN: cellular_component
                     unknown; CONTAINS InterPro DOMAIN/s: Vesicle transport
                     protein, Got1/SFT2-like (InterPro:IPR007305); BEST
                     Arabidopsis thaliana protein match is: Got1/Sft2-like
                     vescicle transport protein family (TAIR:AT3G49420.1)."
                     /product="Got1/Sft2-like vescicle transport protein
     gene            179822..181321
     mRNA            join(179822..179914,179995..180098,180211..180355,
                     /product="hypothetical protein"
     CDS             join(179822..179914,179995..180098,180211..180355,
                     /note="BEST Arabidopsis thaliana protein match is:
                     Insulinase (Peptidase family M16) family protein
                     (TAIR:AT1G06900.1); Has 1807 Blast hits to 1807 proteins
                     in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736;
                     Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes -
                     339 (source: NCBI BLink)."
                     /product="hypothetical protein"
     gene            complement(181821..182581)
     mRNA            complement(join(181821..182151,182239..182312,
                     /product="hypothetical protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AK221153.1"
     CDS             complement(join(182013..182151,182239..182312,
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AK221153.1"
                     /note="unknown protein; FUNCTIONS IN: molecular_function
                     unknown; INVOLVED IN: biological_process unknown; LOCATED
                     IN: mitochondrion; Has 5 Blast hits to 5 proteins in 2
                     species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0;
                     Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source:
                     NCBI BLink)."
                     /product="hypothetical protein"
     gene            complement(183328..186461)
                     /gene_synonym="ABERRANT POLLEN DEVELOPMENT 2"
     mRNA            complement(join(183328..183768,183891..184194,
                     /gene_synonym="ABERRANT POLLEN DEVELOPMENT 2"
                     /product="RING/U-box superfamily protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             complement(join(183693..183768,183891..184194,
                     /gene_synonym="ABERRANT POLLEN DEVELOPMENT 2"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="RING/U-box superfamily protein; FUNCTIONS IN: zinc
                     ion binding; INVOLVED IN: biological_process unknown;
                     LOCATED IN: cellular_component unknown; EXPRESSED IN: 24
                     plant structures; EXPRESSED DURING: 11 growth stages;
                     CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type
                     (InterPro:IPR001841); BEST Arabidopsis thaliana protein
                     match is: RING/U-box superfamily protein
                     (TAIR:AT2G38185.2); Has 1494 Blast hits to 1490 proteins
                     in 181 species: Archae - 0; Bacteria - 0; Metazoa - 838;
                     Fungi - 48; Plants - 298; Viruses - 88; Other Eukaryotes -
                     222 (source: NCBI BLink)."
                     /product="RING/U-box superfamily protein"
     gene            186654..190661
     mRNA            join(186654..187172,187270..187355,187542..187657,
                     /product="LMBR1-like membrane protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             join(186823..187172,187270..187355,187542..187657,
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="LMBR1-like membrane protein; CONTAINS InterPro
                     DOMAIN/s: LMBR1-like membrane protein, conserved region
                     (InterPro:IPR006876); BEST Arabidopsis thaliana protein
                     match is: LMBR1-like membrane protein (TAIR:AT3G08930.1);
                     Has 1807 Blast hits to 1807 proteins in 277 species:
                     Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347;
                     Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source:
                     NCBI BLink)."
                     /product="LMBR1-like membrane protein"
     gene            190863..192793
     mRNA            join(190863..191010,191099..191160,191465..191598,
                     methyltransferases superfamily protein"
     mRNA            join(190863..191010,191099..191160,191465..191598,
                     methyltransferases superfamily protein"
     mRNA            join(190874..191010,191099..191160,191465..191598,
                     methyltransferases superfamily protein"
     mRNA            join(190874..191010,191099..191160,191465..191598,
                     methyltransferases superfamily protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             join(190881..191010,191099..191160,191465..191598,
                     methyltransferases superfamily protein"
     CDS             join(190881..191010,191099..191160,191465..191598,
                     methyltransferases superfamily protein"
     CDS             join(190881..191010,191099..191160,191465..191598,
                     /inference="Similar to RNA sequence,
                     methyltransferases superfamily protein; FUNCTIONS IN:
                     molecular_function unknown; INVOLVED IN:
                     biological_process unknown; LOCATED IN: cellular_component
                     unknown; EXPRESSED IN: 12 plant structures; EXPRESSED
                     DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s:
                     Methyltransferase-16, putative (InterPro:IPR019410); Has
                     30201 Blast hits to 17322 proteins in 780 species: Archae
                     - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422;
                     Plants - 5037; Viruses - 0; Other Eukaryotes - 2996
                     (source: NCBI BLink)."
                     methyltransferases superfamily protein"
     CDS             join(190881..191010,191099..191160,191465..191598,
                     methyltransferases superfamily protein"
     mRNA            join(190909..191010,191099..191160,191465..191598,
                     methyltransferases superfamily protein"
                     /inference="Similar to RNA sequence,
     mRNA            join(190928..191010,191099..191160,191465..191598,
                     methyltransferases superfamily protein"
     mRNA            join(190928..191010,191099..191160,191465..191598,
                     methyltransferases superfamily protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             join(190953..191010,191099..191160,191465..191598,
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     methyltransferases superfamily protein; FUNCTIONS IN:
                     molecular_function unknown; INVOLVED IN:
                     biological_process unknown; LOCATED IN: cellular_component
                     unknown; EXPRESSED IN: 12 plant structures; EXPRESSED
                     DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s:
                     Methyltransferase-16, putative (InterPro:IPR019410); Has
                     375 Blast hits to 375 proteins in 142 species: Archae - 2;
                     Bacteria - 36; Metazoa - 120; Fungi - 106; Plants - 76;
                     Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink)."
                     methyltransferases superfamily protein"
     CDS             join(190953..191010,191099..191160,191465..191598,
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     methyltransferases superfamily protein; CONTAINS InterPro
                     DOMAIN/s: Methyltransferase-16, putative
                     (InterPro:IPR019410); Has 30201 Blast hits to 17322
                     proteins in 780 species: Archae - 12; Bacteria - 1396;
                     Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0;
                     Other Eukaryotes - 2996 (source: NCBI BLink)."
                     methyltransferases superfamily protein"
     CDS             join(190953..191010,191099..191160,191465..191598,
                     methyltransferases superfamily protein"
     gene            192749..194805
     mRNA            192749..194805
                     /product="Cysteine/Histidine-rich C1 domain family
                     /inference="Similar to RNA sequence,
     CDS             192990..194231
                     /inference="Similar to RNA sequence,
                     /note="Cysteine/Histidine-rich C1 domain family protein;
                     FUNCTIONS IN: zinc ion binding; INVOLVED IN: intracellular
                     signaling pathway; LOCATED IN: cellular_component unknown;
                     CONTAINS InterPro DOMAIN/s: Protein kinase C-like, phorbol
                     ester/diacylglycerol binding (InterPro:IPR002219), DC1
                     (InterPro:IPR004146), Zinc finger, PHD-type
                     (InterPro:IPR001965), C1-like (InterPro:IPR011424); BEST
                     Arabidopsis thaliana protein match is:
                     Cysteine/Histidine-rich C1 domain family protein
                     (TAIR:AT2G02610.1); Has 1807 Blast hits to 1807 proteins
                     in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736;
                     Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes -
                     339 (source: NCBI BLink)."
                     /product="Cysteine/Histidine-rich C1 domain family
     gene            complement(194433..194823)
     ncRNA           complement(194433..194823)
                     /product="other RNA"
     gene            194723..194933
     ncRNA           194723..194933
                     /product="other RNA"
     gene            195452..198651
                     /gene_synonym="cation exchanger 4"
                     /note="Encodes a cation/proton antiporter, a member of low
                     affinity calcium antiporter CAX2 family. Involved in root
                     development under metal stress."
     mRNA            join(195452..195876,195984..196051,196160..196188,
                     /gene_synonym="cation exchanger 4"
                     /product="cation exchanger 4"
                     /inference="Similar to RNA sequence,
     mRNA            join(195452..195876,195984..196051,196160..196188,
                     /gene_synonym="cation exchanger 4"
                     /product="cation exchanger 4"
     CDS             join(195589..195876,195984..196051,196160..196188,
                     /gene_synonym="cation exchanger 4"
                     /inference="Similar to RNA sequence,
                     /note="cation exchanger 4 (CAX4); CONTAINS InterPro
                     DOMAIN/s: Sodium/calcium exchanger membrane region
                     (InterPro:IPR004837), Calcium/proton exchanger superfamily
                     (InterPro:IPR004798), Calcium/proton exchanger
                     (InterPro:IPR004713); BEST Arabidopsis thaliana protein
                     match is: cation exchanger 1 (TAIR:AT2G38170.3); Has 3152
                     Blast hits to 2978 proteins in 994 species: Archae - 25;
                     Bacteria - 1749; Metazoa - 60; Fungi - 737; Plants - 238;
                     Viruses - 0; Other Eukaryotes - 343 (source: NCBI BLink)."
                     /product="cation exchanger 4"
     CDS             join(195589..195876,195984..196051,196160..196188,
                     /gene_synonym="cation exchanger 4"
                     /product="cation exchanger 4"
     gene            198906..201586
                     /gene_synonym="thylakoid ATP/ADP carrier"
                     /note="encodes an ATP/ADP carrier that is located to the
                     thylakoid membrane involved in providing ATP during
                     thylakoid biogenesis and turnover"
     mRNA            join(198906..199448,199804..199860,199958..200020,
                     /gene_synonym="thylakoid ATP/ADP carrier"
                     /product="thylakoid ATP/ADP carrier"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             join(199017..199448,199804..199860,199958..200020,
                     /gene_synonym="thylakoid ATP/ADP carrier"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="thylakoid ATP/ADP carrier (TAAC); FUNCTIONS IN:
                     binding, transporter activity, ATP transmembrane
                     transporter activity; INVOLVED IN: photosystem II repair,
                     transport, photoprotection; LOCATED IN: in 7 components;
                     EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 14
                     growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial
                     carrier protein (InterPro:IPR002067), Mitochondrial
                     substrate carrier (InterPro:IPR001993), Mitochondrial
                     substrate/solute carrier (InterPro:IPR018108); BEST
                     Arabidopsis thaliana protein match is: Mitochondrial
                     substrate carrier family protein (TAIR:AT3G51870.1); Has
                     1807 Blast hits to 1807 proteins in 277 species: Archae -
                     0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385;
                     Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink)."
                     /product="thylakoid ATP/ADP carrier"
     gene            201603..205679
                     /gene_synonym="ROOT UV-B SENSITIVE 5"
     mRNA            join(201603..201856,201940..202002,202088..202245,
                     /gene_synonym="ROOT UV-B SENSITIVE 5"
                     /product="root UVB sensitive protein (Protein of unknown
                     function, DUF647)"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             join(201702..201856,201940..202002,202088..202245,
                     /gene_synonym="ROOT UV-B SENSITIVE 5"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="ROOT UV-B SENSITIVE 5 (RUS5); CONTAINS InterPro
                     DOMAIN/s: Protein of unknown function DUF647
                     (InterPro:IPR006968); BEST Arabidopsis thaliana protein
                     match is: Protein of unknown function, DUF647
                     (TAIR:AT3G45890.1); Has 426 Blast hits to 424 proteins in
                     125 species: Archae - 0; Bacteria - 2; Metazoa - 111;
                     Fungi - 69; Plants - 183; Viruses - 0; Other Eukaryotes -
                     61 (source: NCBI BLink)."
                     /product="root UVB sensitive protein (Protein of unknown
                     function, DUF647)"
     gene            206432..208611
                     /gene_synonym="ABA Insensitive RING Protein 2"
     mRNA            join(206432..206861,207453..207603,207703..207769,
                     /gene_synonym="ABA Insensitive RING Protein 2"
                     /product="RING/U-box superfamily protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     mRNA            join(206432..206861,207453..207603,207703..207769,
                     /gene_synonym="ABA Insensitive RING Protein 2"
                     /product="RING/U-box superfamily protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             join(206797..206861,207453..207603,207703..207769,
                     /gene_synonym="ABA Insensitive RING Protein 2"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="RING/U-box superfamily protein; FUNCTIONS IN: zinc
                     ion binding; EXPRESSED IN: 17 plant structures; EXPRESSED
                     DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Zinc
                     finger, RING-type, conserved site (InterPro:IPR017907),
                     Zinc finger, RING-type (InterPro:IPR001841), Zinc finger,
                     C3HC4 RING-type (InterPro:IPR018957); BEST Arabidopsis
                     thaliana protein match is: RING/U-box superfamily protein
                     (TAIR:AT3G47160.1); Has 1807 Blast hits to 1807 proteins
                     in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736;
                     Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes -
                     339 (source: NCBI BLink)."
                     /product="RING/U-box superfamily protein"
     CDS             join(206797..206861,207453..207603,207703..207769,
                     /gene_synonym="ABA Insensitive RING Protein 2"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="RING/U-box superfamily protein; CONTAINS InterPro
                     DOMAIN/s: Zinc finger, RING-type, conserved site
                     (InterPro:IPR017907); BEST Arabidopsis thaliana protein
                     match is: RING/U-box superfamily protein
                     (TAIR:AT3G47160.1); Has 35333 Blast hits to 34131 proteins
                     in 2444 species: Archae - 798; Bacteria - 22429; Metazoa -
                     974; Fungi - 991; Plants - 531; Viruses - 0; Other
                     Eukaryotes - 9610 (source: NCBI BLink)."
                     /product="RING/U-box superfamily protein"
     gene            208866..210548
                     /gene_synonym="light harvesting complex photosystem II"
     mRNA            join(208866..209593,209881..210548)
                     /gene_synonym="light harvesting complex photosystem II"
                     /product="light harvesting complex photosystem II"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             join(209084..209593,209881..210243)
                     /gene_synonym="light harvesting complex photosystem II"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="light harvesting complex photosystem II (LHCB4.1);
                     FUNCTIONS IN: chlorophyll binding; INVOLVED IN: response
                     to blue light, response to red light, response to far red
                     light, photosynthesis; LOCATED IN: in 6 components;
                     EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 14
                     growth stages; CONTAINS InterPro DOMAIN/s: Chlorophyll A-B
                     binding protein (InterPro:IPR001344); BEST Arabidopsis
                     thaliana protein match is: light harvesting complex
                     photosystem II (TAIR:AT3G08940.2); Has 1807 Blast hits to
                     1807 proteins in 277 species: Archae - 0; Bacteria - 0;
                     Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0;
                     Other Eukaryotes - 339 (source: NCBI BLink)."
                     /product="light harvesting complex photosystem II"
     gene            complement(210979..213472)
                     /gene_synonym="L-type lectin receptor kinase-VI.2"
                     /gene_synonym="lectin receptor kinase a4.1"
                     /note="Encodes LecRKA4.1, a member of the lectin receptor
                     kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2
                     At5g01550; LecRKA4.3 At5g01560). Together with other
                     members of the subfamily, functions redundantly in the
                     negative regulation of ABA response in seed germination.
                     Positively regulates pattern-triggered immunity."
     mRNA            complement(210979..213472)
                     /gene_synonym="L-type lectin receptor kinase-VI.2"
                     /gene_synonym="lectin receptor kinase a4.1"
                     /product="lectin receptor kinase a4.1"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     gene            211017..213593
                     /note="Natural antisense transcript overlaps with
                     Potential natural antisense gene, locus overlaps with
     ncRNA           211017..213593
                     /product="other RNA"
     CDS             complement(211285..213333)
                     /gene_synonym="L-type lectin receptor kinase-VI.2"
                     /gene_synonym="lectin receptor kinase a4.1"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="lectin receptor kinase a4.1 (LECRKA4.1); FUNCTIONS
                     IN: kinase activity; INVOLVED IN: N-terminal protein
                     myristoylation, abscisic acid mediated signaling pathway,
                     response to abscisic acid stimulus, seed germination;
                     LOCATED IN: plasma membrane; EXPRESSED IN: 17 plant
                     structures; EXPRESSED DURING: 10 growth stages; CONTAINS
                     InterPro DOMAIN/s: Legume lectin, beta chain
                     (InterPro:IPR001220), Protein kinase, ATP binding site
                     (InterPro:IPR017441), Serine/threonine-protein kinase-like
                     domain (InterPro:IPR017442), Concanavalin A-like
                     lectin/glucanase, subgroup (InterPro:IPR013320), Protein
                     kinase-like domain (InterPro:IPR011009),
                     Serine/threonine-protein kinase, active site
                     (InterPro:IPR008271), Protein kinase, catalytic domain
                     (InterPro:IPR000719), Concanavalin A-like lectin/glucanase
                     (InterPro:IPR008985); BEST Arabidopsis thaliana protein
                     match is: lectin receptor kinase a4.1 (TAIR:AT5G01550.1);
                     Has 1807 Blast hits to 1807 proteins in 277 species:
                     Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347;
                     Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source:
                     NCBI BLink)."
                     /product="lectin receptor kinase a4.1"
     gene            complement(214373..216773)
                     /gene_synonym="L-type lectin receptor kinase VI.3"
                     /gene_synonym="lectin receptor kinase a4.1"
                     /note="Encodes LecRKA4.2, a member of the lectin receptor
                     kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2
                     At5g01550; LecRKA4.3 At5g01560). Together with other
                     members of the subfamily, functions redundantly in the
                     negative regulation of ABA response in seed germination."
     mRNA            complement(214373..216773)
                     /gene_synonym="L-type lectin receptor kinase VI.3"
                     /gene_synonym="lectin receptor kinase a4.1"
                     /product="lectin receptor kinase a4.1"
                     /inference="Similar to RNA sequence,
     CDS             complement(214517..216637)
                     /gene_synonym="L-type lectin receptor kinase VI.3"
                     /gene_synonym="lectin receptor kinase a4.1"
                     /inference="Similar to RNA sequence,
                     /note="lectin receptor kinase a4.1 (LECRKA4.2); FUNCTIONS
                     IN: protein serine/threonine kinase activity, binding,
                     protein kinase activity, kinase activity, ATP binding;
                     INVOLVED IN: abscisic acid mediated signaling pathway,
                     seed germination; EXPRESSED IN: 6 plant structures;
                     EXPRESSED DURING: 4 anthesis, petal differentiation and
                     expansion stage; CONTAINS InterPro DOMAIN/s: Legume
                     lectin, beta chain (InterPro:IPR001220), Protein kinase,
                     ATP binding site (InterPro:IPR017441),
                     Serine/threonine-protein kinase-like domain
                     (InterPro:IPR017442), Concanavalin A-like
                     lectin/glucanase, subgroup (InterPro:IPR013320), Protein
                     kinase-like domain (InterPro:IPR011009),
                     Serine/threonine-protein kinase, active site
                     (InterPro:IPR008271), Protein kinase, catalytic domain
                     (InterPro:IPR000719), Concanavalin A-like lectin/glucanase
                     (InterPro:IPR008985); BEST Arabidopsis thaliana protein
                     match is: lectin receptor kinase a4.3 (TAIR:AT5G01560.1);
                     Has 1807 Blast hits to 1807 proteins in 277 species:
                     Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347;
                     Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source:
                     NCBI BLink)."
                     /product="lectin receptor kinase a4.1"
     gene            complement(218029..221198)
                     /gene_synonym="L-type lectin receptor kinase VI.4"
                     /gene_synonym="lectin receptor kinase a4.3"
                     /note="Encodes LecRKA4.3, a member of the lectin receptor
                     kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2
                     At5g01550; LecRKA4.3 At5g01560). Together with other
                     members of the subfamily, functions redundantly in the
                     negative regulation of ABA response in seed germination."
     mRNA            complement(218029..221198)
                     /gene_synonym="L-type lectin receptor kinase VI.4"
                     /gene_synonym="lectin receptor kinase a4.3"
                     /product="lectin receptor kinase a4.3"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             complement(218170..220245)
                     /gene_synonym="L-type lectin receptor kinase VI.4"
                     /gene_synonym="lectin receptor kinase a4.3"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="lectin receptor kinase a4.3 (LECRKA4.3); FUNCTIONS
                     IN: kinase activity; INVOLVED IN: abscisic acid mediated
                     signaling pathway, seed germination; LOCATED IN:
                     endomembrane system; CONTAINS InterPro DOMAIN/s: Legume
                     lectin, beta chain (InterPro:IPR001220), Protein kinase,
                     ATP binding site (InterPro:IPR017441),
                     Serine/threonine-protein kinase-like domain
                     (InterPro:IPR017442), Concanavalin A-like
                     lectin/glucanase, subgroup (InterPro:IPR013320), Protein
                     kinase-like domain (InterPro:IPR011009),
                     Serine/threonine-protein kinase, active site
                     (InterPro:IPR008271), Protein kinase, catalytic domain
                     (InterPro:IPR000719), Concanavalin A-like lectin/glucanase
                     (InterPro:IPR008985); BEST Arabidopsis thaliana protein
                     match is: lectin receptor kinase a4.1 (TAIR:AT5G01550.1);
                     Has 124782 Blast hits to 123109 proteins in 4852 species:
                     Archae - 131; Bacteria - 14218; Metazoa - 45637; Fungi -
                     10709; Plants - 35284; Viruses - 441; Other Eukaryotes -
                     18362 (source: NCBI BLink)."
                     /product="lectin receptor kinase a4.3"
     gene            220974..222798
     mRNA            join(220974..221124,221323..221538,221607..221748,
                     /product="plectin-like protein"
     mRNA            join(221129..221538,221607..221748,221828..221929,
                     /product="plectin-like protein"
     mRNA            join(221129..221538,221607..221748,221828..221929,
                     /product="plectin-like protein"
     mRNA            join(221129..221538,221607..221748,221828..221929,
                     /product="plectin-like protein"
     mRNA            join(221308..221538,221607..221748,221828..221929,
                     /product="plectin-like protein"
                     /inference="Similar to RNA sequence, EST:INSD:EG421705.1"
     CDS             join(221367..221538,221607..221748,221828..221929,
                     /inference="Similar to RNA sequence, EST:INSD:EG421705.1"
                     /note="unknown protein; BEST Arabidopsis thaliana protein
                     match is: unknown protein (TAIR:AT3G08880.1); Has 1807
                     Blast hits to 1807 proteins in 277 species: Archae - 0;
                     Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385;
                     Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink)."
                     /product="plectin-like protein"
     CDS             join(221367..221538,221607..221748,221828..221929,
                     /product="plectin-like protein"
     CDS             join(221367..221538,221607..221748,221828..221929,
                     /product="plectin-like protein"
     CDS             join(221367..221538,221607..221748,221828..221929,
                     /product="plectin-like protein"
     CDS             join(221367..221538,221607..221748,221828..221929,
                     /product="plectin-like protein"
     gene            222511..224034
                     /note="Natural antisense transcript overlaps with
     ncRNA           join(222511..222669,222764..222866,223196..223399,
                     /product="other RNA"
     ncRNA           join(222528..222866,223196..223399,223488..224034)
                     /product="other RNA"
     gene            complement(222760..223852)
                     /gene_synonym="OAS HIGH ACCUMULATION 1"
                     /note="thiol reductase in OAS metabolism"
     mRNA            complement(join(222760..222921,223003..223095,
                     /gene_synonym="OAS HIGH ACCUMULATION 1"
                     /product="gamma interferon responsive lysosomal thiol
                     (GILT) reductase family protein"
                     /inference="Similar to RNA sequence, EST:INSD:EG498736.1"
     CDS             complement(join(222760..222921,223003..223095,
                     /gene_synonym="OAS HIGH ACCUMULATION 1"
                     /inference="Similar to RNA sequence, EST:INSD:EG498736.1"
                     /note="OAS HIGH ACCUMULATION 1 (OSH1); FUNCTIONS IN:
                     catalytic activity; INVOLVED IN: biological_process
                     unknown; LOCATED IN: endomembrane system; CONTAINS
                     InterPro DOMAIN/s: Gamma interferon inducible lysosomal
                     thiol reductase GILT (InterPro:IPR004911); BEST
                     Arabidopsis thaliana protein match is: Thioredoxin
                     superfamily protein (TAIR:AT1G07080.1); Has 1807 Blast
                     hits to 1807 proteins in 277 species: Archae - 0; Bacteria
                     - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses -
                     0; Other Eukaryotes - 339 (source: NCBI BLink)."
                     /product="gamma interferon responsive lysosomal thiol
                     (GILT) reductase family protein"
     ncRNA           join(222930..223399,223488..224033)
                     /product="other RNA"
     gene            224134..226926
                     /gene_synonym="TRANSLOCON AT THE INNER ENVELOPE MEMBRANE
                     OF CHLOROPLASTS 56"
     mRNA            join(224134..224942,225406..225603,225723..226005,
                     /gene_synonym="TRANSLOCON AT THE INNER ENVELOPE MEMBRANE
                     OF CHLOROPLASTS 56"
                     /product="histone-lysine N-methyltransferase ATXR3-like
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             join(224249..224942,225406..225603,225723..226005,
                     /gene_synonym="TRANSLOCON AT THE INNER ENVELOPE MEMBRANE
                     OF CHLOROPLASTS 56"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="unknown protein; FUNCTIONS IN: molecular_function
                     unknown; INVOLVED IN: biological_process unknown; LOCATED
                     IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22
                     plant structures; EXPRESSED DURING: 13 growth stages; Has
                     60 Blast hits to 59 proteins in 31 species: Archae - 0;
                     Bacteria - 20; Metazoa - 1; Fungi - 2; Plants - 33;
                     Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink)."
                     /product="histone-lysine N-methyltransferase ATXR3-like
     gene            226972..229286
                     /note="Natural antisense transcript overlaps with
                     Potential natural antisense gene, locus overlaps with
     ncRNA           join(226972..227129,227757..227838,229263..229286)
                     /product="other RNA"
     gene            complement(227953..230051)
                     /gene_synonym="ARABIDOPSIS THALIANA FERRETIN 1"
                     /gene_synonym="ferretin 1"
                     /note="Encodes a ferretin protein that is targeted to the
                     chloroplast. Member of a Ferritin gene family. Gene
                     expression is induced in response to iron overload and by
                     nitric oxide. Expression of the gene is downregulated in
                     the presence of paraquat, an inducer of photoxidative
     mRNA            complement(join(227953..228183,228272..228335,
                     /gene_synonym="ARABIDOPSIS THALIANA FERRETIN 1"
                     /gene_synonym="ferretin 1"
                     /product="ferretin 1"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             complement(join(228149..228183,228272..228335,
                     /gene_synonym="ARABIDOPSIS THALIANA FERRETIN 1"
                     /gene_synonym="ferretin 1"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="ferretin 1 (FER1); FUNCTIONS IN: ferric iron
                     binding, iron ion binding; INVOLVED IN: in 12 processes;
                     LOCATED IN: thylakoid, chloroplast thylakoid membrane,
                     chloroplast stroma, chloroplast, membrane; EXPRESSED IN:
                     25 plant structures; EXPRESSED DURING: 15 growth stages;
                     CONTAINS InterPro DOMAIN/s: Ferritin, N-terminal
                     (InterPro:IPR001519), Ferritin-related
                     (InterPro:IPR012347), Ferritin-like (InterPro:IPR009040),
                     Ferritin, conserved site (InterPro:IPR014034),
                     Ferritin/ribonucleotide reductase-like
                     (InterPro:IPR009078), Ferritin/Dps protein
                     (InterPro:IPR008331); BEST Arabidopsis thaliana protein
                     match is: ferritin 4 (TAIR:AT2G40300.1); Has 1807 Blast
                     hits to 1807 proteins in 277 species: Archae - 0; Bacteria
                     - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses -
                     0; Other Eukaryotes - 339 (source: NCBI BLink)."
                     /product="ferretin 1"
     gene            230829..232216
     mRNA            join(230829..230839,230947..231161,231485..231539,
                     /product="hypothetical protein (Protein of unknown
                     function, DUF538)"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     mRNA            join(230843..231161,231485..231539,231624..232216)
                     /product="hypothetical protein (Protein of unknown
                     function, DUF538)"
     CDS             join(231075..231161,231485..231539,231624..231994)
                     /product="hypothetical protein (Protein of unknown
                     function, DUF538)"
     CDS             join(231075..231161,231485..231539,231624..231994)
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="Protein of unknown function, DUF538; CONTAINS
                     InterPro DOMAIN/s: Protein of unknown function DUF538
                     (InterPro:IPR007493); BEST Arabidopsis thaliana protein
                     match is: Protein of unknown function, DUF538
                     (TAIR:AT3G08890.2); Has 1807 Blast hits to 1807 proteins
                     in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736;
                     Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes -
                     339 (source: NCBI BLink)."
                     /product="hypothetical protein (Protein of unknown
                     function, DUF538)"
     gene            232565..234916
                     /gene_synonym="TRICHOME BIREFRINGENCE-LIKE 35"
                     /note="Encodes a member of the TBL (TRICHOME
                     BIREFRINGENCE-LIKE) gene family containing a
                     plant-specific DUF231 (domain of unknown function) domain.
                     TBL gene family has 46 members, two of which
                     (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be
                     involved in the synthesis and deposition of secondary wall
                     cellulose, presumably by influencing the esterification
                     state of pectic polymers. A nomenclature for this gene
                     family has been proposed (Volker Bischoff & Wolf Scheible,
                     2010, personal communication)."
     mRNA            join(232565..232659,232774..233092,233207..233492,
                     /gene_synonym="TRICHOME BIREFRINGENCE-LIKE 35"
                     /product="TRICHOME BIREFRINGENCE-LIKE 35"
     mRNA            join(232585..233092,233207..233492,233691..233862,
                     /gene_synonym="TRICHOME BIREFRINGENCE-LIKE 35"
                     /product="TRICHOME BIREFRINGENCE-LIKE 35"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     mRNA            join(232732..233092,233183..233492,233691..233862,
                     /gene_synonym="TRICHOME BIREFRINGENCE-LIKE 35"
                     /product="TRICHOME BIREFRINGENCE-LIKE 35"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             join(232882..233092,233183..233492,233691..233862,
                     /gene_synonym="TRICHOME BIREFRINGENCE-LIKE 35"
                     /note="TRICHOME BIREFRINGENCE-LIKE 35 (TBL35); LOCATED IN:
                     endomembrane system; EXPRESSED IN: 22 plant structures;
                     EXPRESSED DURING: 14 growth stages; CONTAINS InterPro
                     DOMAIN/s: Protein of unknown function DUF231, plant
                     (InterPro:IPR004253); BEST Arabidopsis thaliana protein
                     match is: TRICHOME BIREFRINGENCE-LIKE 34
                     /product="TRICHOME BIREFRINGENCE-LIKE 35"
     CDS             join(232882..233092,233207..233492,233691..233862,
                     /gene_synonym="TRICHOME BIREFRINGENCE-LIKE 35"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="TRICHOME BIREFRINGENCE-LIKE 35 (TBL35); LOCATED IN:
                     endomembrane system; EXPRESSED IN: 23 plant structures;
                     EXPRESSED DURING: 14 growth stages; CONTAINS InterPro
                     DOMAIN/s: Protein of unknown function DUF231, plant
                     (InterPro:IPR004253); BEST Arabidopsis thaliana protein
                     match is: TRICHOME BIREFRINGENCE-LIKE 34
                     (TAIR:AT2G38320.1); Has 30201 Blast hits to 17322 proteins
                     in 780 species: Archae - 12; Bacteria - 1396; Metazoa -
                     17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other
                     Eukaryotes - 2996 (source: NCBI BLink)."
                     /product="TRICHOME BIREFRINGENCE-LIKE 35"
     CDS             join(232882..233092,233207..233492,233691..233862,
                     /gene_synonym="TRICHOME BIREFRINGENCE-LIKE 35"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="TRICHOME BIREFRINGENCE-LIKE 35; LOCATED IN:
                     endomembrane system; EXPRESSED IN: 23 plant structures;
                     EXPRESSED DURING: 14 growth stages; CONTAINS InterPro
                     DOMAIN/s: Protein of unknown function DUF231, plant
                     (InterPro:IPR004253); BEST Arabidopsis thaliana protein
                     match is: TRICHOME BIREFRINGENCE-LIKE 34
                     (TAIR:AT2G38320.1); Has 1369 Blast hits to 1347 proteins
                     in 38 species: Archae - 0; Bacteria - 0; Metazoa - 25;
                     Fungi - 0; Plants - 1344; Viruses - 0; Other Eukaryotes -
                     0 (source: NCBI BLink)."
                     /product="TRICHOME BIREFRINGENCE-LIKE 35"
     gene            complement(234851..241106)
                     /gene_synonym="BRCA2-like B"
                     /note="Ortholog of breast cancer susceptibility protein 2.
                     Essential at meiosis. Interacts with with both Rad51 and
                     Dss1(I) or both Dmc1 and Dss1(I) in a tripartite complex."
     mRNA            complement(join(234851..235182,235275..235448,
                     /gene_synonym="BRCA2-like B"
                     /product="BRCA2-like B"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             complement(join(235117..235182,235275..235448,
                     /gene_synonym="BRCA2-like B"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="BRCA2-like B (BRCA2B); FUNCTIONS IN:
                     single-stranded DNA binding; INVOLVED IN: meiosis; LOCATED
                     IN: mitochondrion; CONTAINS InterPro DOMAIN/s: Nucleic
                     acid-binding, OB-fold-like (InterPro:IPR016027), DNA
                     recombination/repair protein BRCA2, helical domain
                     (InterPro:IPR015252), DNA recombination and repair
                     protein, BRCA2 (InterPro:IPR011370), BRCA2,
                     oligonucleotide/oligosaccharide-binding 1
                     (InterPro:IPR015187), Breast cancer type 2 susceptibility
                     protein (InterPro:IPR015525), BRCA2 repeat
                     (InterPro:IPR002093); BEST Arabidopsis thaliana protein
                     match is: BREAST CANCER 2 like 2A (TAIR:AT4G00020.1); Has
                     281 Blast hits to 210 proteins in 91 species: Archae - 0;
                     Bacteria - 4; Metazoa - 134; Fungi - 18; Plants - 61;
                     Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink)."
                     /product="BRCA2-like B"
     gene            complement(241212..242322)
                     /gene_synonym="prenylated RAB acceptor 1.B5"
     mRNA            complement(241212..242322)
                     /gene_synonym="prenylated RAB acceptor 1.B5"
                     /product="prenylated RAB acceptor 1.B5"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             complement(241442..242113)
                     /gene_synonym="prenylated RAB acceptor 1.B5"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="prenylated RAB acceptor 1.B5 (PRA1.B5); CONTAINS
                     InterPro DOMAIN/s: Prenylated rab acceptor PRA1
                     (InterPro:IPR004895); BEST Arabidopsis thaliana protein
                     match is: prenylated RAB acceptor 1.B4 (TAIR:AT2G38360.1);
                     Has 1807 Blast hits to 1807 proteins in 277 species:
                     Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347;
                     Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source:
                     NCBI BLink)."
                     /product="prenylated RAB acceptor 1.B5"
     gene            complement(242450..244111)
     mRNA            complement(join(242450..242769,243248..243448,
                     /product="Tautomerase/MIF superfamily protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     mRNA            complement(join(242450..242769,243034..243123,
                     /product="Tautomerase/MIF superfamily protein"
                     /inference="Similar to RNA sequence,
     mRNA            complement(join(242450..243123,243248..243448,
                     /product="Tautomerase/MIF superfamily protein"
     mRNA            complement(join(242579..242769,243034..243448,
                     /product="Tautomerase/MIF superfamily protein"
     CDS             complement(join(242734..242769,243248..243448,
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="Tautomerase/MIF superfamily protein; FUNCTIONS IN:
                     molecular_function unknown; INVOLVED IN: inflammatory
                     response, response to other organism; LOCATED IN:
                     chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED
                     DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s:
                     Tautomerase (InterPro:IPR014347), Macrophage migration
                     inhibitory factor (InterPro:IPR001398); BEST Arabidopsis
                     thaliana protein match is: Tautomerase/MIF superfamily
                     protein (TAIR:AT5G57170.1); Has 1807 Blast hits to 1807
                     proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa
                     - 736; Fungi - 347; Plants - 385; Viruses - 0; Other
                     Eukaryotes - 339 (source: NCBI BLink)."
                     /product="Tautomerase/MIF superfamily protein"
     CDS             complement(join(243067..243123,243248..243448,
                     /product="Tautomerase/MIF superfamily protein"
     CDS             complement(join(243067..243123,243248..243448,
                     /inference="Similar to RNA sequence,
                     /note="Tautomerase/MIF superfamily protein; FUNCTIONS IN:
                     molecular_function unknown; INVOLVED IN: inflammatory
                     response, response to other organism; EXPRESSED IN: 23
                     plant structures; EXPRESSED DURING: 13 growth stages;
                     CONTAINS InterPro DOMAIN/s: Tautomerase
                     (InterPro:IPR014347), Macrophage migration inhibitory
                     factor (InterPro:IPR001398); BEST Arabidopsis thaliana
                     protein match is: Tautomerase/MIF superfamily protein
                     (TAIR:AT5G57170.2); Has 820 Blast hits to 820 proteins in
                     207 species: Archae - 0; Bacteria - 141; Metazoa - 384;
                     Fungi - 26; Plants - 141; Viruses - 0; Other Eukaryotes -
                     128 (source: NCBI BLink)."
                     /product="Tautomerase/MIF superfamily protein"
     CDS             complement(join(243209..243448,243923..244033))
                     /product="Tautomerase/MIF superfamily protein"
     gene            complement(244250..249207)
     mRNA            complement(join(244250..244593,244681..244870,
                     /product="influenza virus NS1A-binding protein"
     mRNA            complement(join(244250..244593,244681..244870,
                     /product="influenza virus NS1A-binding protein"
                     /inference="Similar to RNA sequence,
     CDS             complement(join(244504..244593,244681..244870,
                     /product="influenza virus NS1A-binding protein"
     CDS             complement(join(244504..244593,244681..244870,
                     /inference="Similar to RNA sequence,
                     /note="CONTAINS InterPro DOMAIN/s: Galactose
                     oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch
                     repeat type 1 (InterPro:IPR006652), Development/cell death
                     domain (InterPro:IPR013989), Kelch related
                     (InterPro:IPR013089), Kelch-type beta propeller
                     (InterPro:IPR015915); BEST Arabidopsis thaliana protein
                     match is: DCD (Development and Cell Death) domain protein
                     (TAIR:AT3G11000.1); Has 16133 Blast hits to 7053 proteins
                     in 482 species: Archae - 40; Bacteria - 1227; Metazoa -
                     10756; Fungi - 311; Plants - 1896; Viruses - 673; Other
                     Eukaryotes - 1230 (source: NCBI BLink)."
                     /product="influenza virus NS1A-binding protein"
     mRNA            complement(join(245279..245747,246111..246450,
                     /product="influenza virus NS1A-binding protein"
     CDS             complement(join(245512..245747,246111..246450,
                     /product="influenza virus NS1A-binding protein"
     gene            251686..253972
     mRNA            join(251686..252143,252298..252348,252448..252690,
                     /product="NAD(P)-linked oxidoreductase superfamily
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     mRNA            join(251686..252143,252298..252348,252448..252521,
                     /product="NAD(P)-linked oxidoreductase superfamily
                     /inference="Similar to RNA sequence,
     CDS             join(252000..252143,252298..252348,252448..252690,
                     /inference="Similar to RNA sequence,
                     /note="NAD(P)-linked oxidoreductase superfamily protein;
                     FUNCTIONS IN: oxidoreductase activity; INVOLVED IN:
                     oxidation reduction; EXPRESSED IN: 18 plant structures;
                     EXPRESSED DURING: 11 growth stages; CONTAINS InterPro
                     DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395),
                     Aldo/keto reductase subgroup (InterPro:IPR020471),
                     Aldo/keto reductase, conserved site (InterPro:IPR018170);
                     BEST Arabidopsis thaliana protein match is: NAD(P)-linked
                     oxidoreductase superfamily protein (TAIR:AT2G37770.2); Has
                     16960 Blast hits to 16922 proteins in 2239 species: Archae
                     - 315; Bacteria - 10569; Metazoa - 1835; Fungi - 1554;
                     Plants - 1108; Viruses - 0; Other Eukaryotes - 1579
                     (source: NCBI BLink)."
                     /product="NAD(P)-linked oxidoreductase superfamily
     CDS             join(252000..252143,252298..252348,252448..252521,
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="NAD(P)-linked oxidoreductase superfamily protein;
                     FUNCTIONS IN: oxidoreductase activity; INVOLVED IN:
                     oxidation reduction; EXPRESSED IN: 18 plant structures;
                     EXPRESSED DURING: 11 growth stages; CONTAINS InterPro
                     DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395),
                     Aldo/keto reductase subgroup (InterPro:IPR020471),
                     Aldo/keto reductase, conserved site (InterPro:IPR018170);
                     BEST Arabidopsis thaliana protein match is: NAD(P)-linked
                     oxidoreductase superfamily protein (TAIR:AT2G37770.2); Has
                     19068 Blast hits to 19040 proteins in 2308 species: Archae
                     - 339; Bacteria - 12194; Metazoa - 2060; Fungi - 1600;
                     Plants - 1171; Viruses - 0; Other Eukaryotes - 1704
                     (source: NCBI BLink)."
                     /product="NAD(P)-linked oxidoreductase superfamily
     gene            complement(253996..256640)
                     /gene_synonym="ARABIDOPSIS THALIANA CATION/HYDROGEN
                     EXCHANGER 26"
                     /gene_synonym="cation/H+ exchanger 26"
                     /note="member of Putative Na+/H+ antiporter family"
     mRNA            complement(join(253996..254238,254315..255202,
                     /gene_synonym="ARABIDOPSIS THALIANA CATION/HYDROGEN
                     EXCHANGER 26"
                     /gene_synonym="cation/H+ exchanger 26"
                     /product="cation/H+ exchanger 26"
     CDS             complement(join(253996..254238,254315..255202,
                     /gene_synonym="ARABIDOPSIS THALIANA CATION/HYDROGEN
                     EXCHANGER 26"
                     /gene_synonym="cation/H+ exchanger 26"
                     /note="cation/H+ exchanger 26 (CHX26); FUNCTIONS IN:
                     monovalent cation:hydrogen antiporter activity,
                     sodium:hydrogen antiporter activity; INVOLVED IN: cation
                     transport; LOCATED IN: integral to membrane; EXPRESSED IN:
                     male gametophyte, leaf, pollen tube; CONTAINS InterPro
                     DOMAIN/s: Cation/H+ exchanger (InterPro:IPR006153); BEST
                     Arabidopsis thaliana protein match is: cation/H+ exchanger
                     27 (TAIR:AT5G01690.1); Has 1807 Blast hits to 1807
                     proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa
                     - 736; Fungi - 347; Plants - 385; Viruses - 0; Other
                     Eukaryotes - 339 (source: NCBI BLink)."
                     /product="cation/H+ exchanger 26"
     gene            257306..260490
                     /gene_synonym="ARABIDOPSIS THALIANA CATION/HYDROGEN
                     EXCHANGER 27"
                     /gene_synonym="cation/H+ exchanger 27"
                     /note="member of Putative Na+/H+ antiporter family"
     mRNA            join(257306..257628,257769..258281,258516..259013,
                     /gene_synonym="ARABIDOPSIS THALIANA CATION/HYDROGEN
                     EXCHANGER 27"
                     /gene_synonym="cation/H+ exchanger 27"
                     /product="cation/H+ exchanger 27"
     CDS             join(257410..257628,257769..258281,258516..259013,
                     /gene_synonym="ARABIDOPSIS THALIANA CATION/HYDROGEN
                     EXCHANGER 27"
                     /gene_synonym="cation/H+ exchanger 27"
                     /note="cation/H+ exchanger 27 (CHX27); BEST Arabidopsis
                     thaliana protein match is: cation/H+ exchanger 26
                     (TAIR:AT5G01680.1); Has 1807 Blast hits to 1807 proteins
                     in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736;
                     Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes -
                     339 (source: NCBI BLink)."
                     /product="cation/H+ exchanger 27"
     gene            complement(260723..263451)
     mRNA            complement(join(260723..261147,261229..261452,
                     /product="Protein phosphatase 2C family protein"
                     /inference="similar to RNA sequence,
     mRNA            complement(join(260748..261147,261229..261452,
                     /product="Protein phosphatase 2C family protein"
                     /inference="similar to RNA sequence, mRNA:INSD:BX831823.1"
     CDS             complement(join(260848..261147,261229..261452,
                     /inference="similar to RNA sequence,
                     /note="Protein phosphatase 2C family protein; FUNCTIONS
                     IN: protein serine/threonine phosphatase activity,
                     catalytic activity; INVOLVED IN: biological_process
                     unknown; LOCATED IN: cellular_component unknown; EXPRESSED
                     IN: 9 plant structures; EXPRESSED DURING: L mature pollen
                     stage, M germinated pollen stage, 4 anthesis, petal
                     differentiation and expansion stage; CONTAINS InterPro
                     DOMAIN/s: Protein phosphatase 2C-related
                     (InterPro:IPR001932), Protein phosphatase 2C
                     (InterPro:IPR015655), Protein phosphatase 2C, N-terminal
                     (InterPro:IPR014045); BEST Arabidopsis thaliana protein
                     match is: Protein phosphatase 2C family protein
                     (TAIR:AT5G36250.1); Has 5499 Blast hits to 5498 proteins
                     in 290 species: Archae - 0; Bacteria - 8; Metazoa - 1364;
                     Fungi - 621; Plants - 2393; Viruses - 5; Other Eukaryotes
                     - 1108 (source: NCBI BLink)."
                     /product="Protein phosphatase 2C family protein"
     CDS             complement(join(260848..261147,261229..261452,
                     /inference="similar to RNA sequence, mRNA:INSD:BX831823.1"
                     /note="Protein phosphatase 2C family protein; FUNCTIONS
                     IN: protein serine/threonine phosphatase activity,
                     catalytic activity; INVOLVED IN: biological_process
                     unknown; LOCATED IN: cellular_component unknown; EXPRESSED
                     IN: 9 plant structures; EXPRESSED DURING: L mature pollen
                     stage, M germinated pollen stage, 4 anthesis, petal
                     differentiation and expansion stage; CONTAINS InterPro
                     DOMAIN/s: Protein phosphatase 2C-related
                     (InterPro:IPR001932), Protein phosphatase 2C
                     (InterPro:IPR015655), Protein phosphatase 2C, N-terminal
                     (InterPro:IPR014045); BEST Arabidopsis thaliana protein
                     match is: Protein phosphatase 2C family protein
                     (TAIR:AT3G02750.2); Has 5490 Blast hits to 5489 proteins
                     in 289 species: Archae - 0; Bacteria - 8; Metazoa - 1364;
                     Fungi - 619; Plants - 2389; Viruses - 5; Other Eukaryotes
                     - 1105 (source: NCBI BLink)."
                     /product="Protein phosphatase 2C family protein"
     gene            complement(263511..265633)
     mRNA            complement(263511..265633)
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             complement(263709..265250)
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="methyltransferases; FUNCTIONS IN: methyltransferase
                     activity; INVOLVED IN: metabolic process; LOCATED IN:
                     endomembrane system; EXPRESSED IN: sperm cell, male
                     gametophyte, pollen tube; EXPRESSED DURING: L mature
                     pollen stage, M germinated pollen stage; CONTAINS InterPro
                     DOMAIN/s: Methyltransferase FkbM (InterPro:IPR006342),
                     Methyltransferase type 11 (InterPro:IPR013216); BEST
                     Arabidopsis thaliana protein match is: unknown protein
                     (TAIR:AT3G53400.1); Has 1807 Blast hits to 1807 proteins
                     in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736;
                     Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes -
                     339 (source: NCBI BLink)."
     misc_feature    complement(265379..265492)
     gene            complement(266278..270646)
     mRNA            complement(join(266278..267171,267315..267566,
                     /product="RNI-like superfamily protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     gene            266640..266874
                     /note="Natural antisense transcript overlaps with
     ncRNA           266640..266874
                     /product="other RNA"
     CDS             complement(join(267118..267171,267315..267566,
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="RNI-like superfamily protein; FUNCTIONS IN:
                     ubiquitin-protein ligase activity; INVOLVED IN:
                     ubiquitin-dependent protein catabolic process; LOCATED IN:
                     endomembrane system; EXPRESSED IN: 17 plant structures;
                     EXPRESSED DURING: 8 growth stages; CONTAINS InterPro
                     DOMAIN/s: Leucine-rich repeat, cysteine-containing subtype
                     (InterPro:IPR006553); BEST Arabidopsis thaliana protein
                     match is: F-box family protein (TAIR:AT5G27920.1); Has
                     15959 Blast hits to 6468 proteins in 357 species: Archae -
                     0; Bacteria - 920; Metazoa - 6194; Fungi - 1434; Plants -
                     4975; Viruses - 16; Other Eukaryotes - 2420 (source: NCBI
                     /product="RNI-like superfamily protein"
     gene            267185..269354
     misc_RNA        join(267185..268739,268828..269018,269178..269354)
                     /note="pseudogene of RNI-like superfamily protein;
     gene            complement(272832..277886)
                     /gene_synonym="SCAR family protein 4"
                     /note="Encodes a member of the SCAR family.These proteins
                     are part of a complex (WAVE) complex.The SCAR subunit
                     activates the ARP2/3 complex which in turn act as a
                     nucleator for actin filaments."
     mRNA            complement(join(272832..273069,273192..273305,
                     /gene_synonym="SCAR family protein 4"
                     /product="SCAR family protein 4"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     gene            272839..276426
                     /note="Natural antisense transcript overlaps with
                     Potential natural antisense gene, locus overlaps with
     ncRNA           join(272839..273647,273724..275937,276024..276426)
                     /product="other RNA"
     mRNA            complement(join(273019..273069,273192..273305,
                     /gene_synonym="SCAR family protein 4"
                     /product="SCAR family protein 4"
     mRNA            complement(join(273019..273069,273192..273305,
                     /gene_synonym="SCAR family protein 4"
                     /product="SCAR family protein 4"
     mRNA            complement(join(273019..273069,273192..273305,
                     /gene_synonym="SCAR family protein 4"
                     /product="SCAR family protein 4"
     CDS             complement(join(273019..273069,273192..273305,
                     /gene_synonym="SCAR family protein 4"
                     /product="SCAR family protein 4"
     CDS             complement(join(273019..273069,273192..273305,
                     /gene_synonym="SCAR family protein 4"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="SCAR family protein 4 (SCAR4); FUNCTIONS IN:
                     molecular_function unknown; INVOLVED IN: positive
                     regulation of actin nucleation; LOCATED IN: SCAR complex,
                     chloroplast, plastoglobule; EXPRESSED IN: 23 plant
                     structures; EXPRESSED DURING: 12 growth stages; BEST
                     Arabidopsis thaliana protein match is: SCAR homolog 2
                     (TAIR:AT2G38440.1); Has 1330 Blast hits to 874 proteins in
                     188 species: Archae - 2; Bacteria - 349; Metazoa - 454;
                     Fungi - 169; Plants - 213; Viruses - 0; Other Eukaryotes -
                     143 (source: NCBI BLink)."
                     /product="SCAR family protein 4"
     mRNA            complement(join(273019..273069,273192..273305,
                     /gene_synonym="SCAR family protein 4"
                     /product="SCAR family protein 4"
     CDS             complement(join(273019..273069,273192..273305,
                     /gene_synonym="SCAR family protein 4"
                     /product="SCAR family protein 4"
     CDS             complement(join(273019..273069,273192..273305,
                     /gene_synonym="SCAR family protein 4"
                     /product="SCAR family protein 4"
     CDS             complement(join(273019..273069,273192..273305,
                     /gene_synonym="SCAR family protein 4"
                     /product="SCAR family protein 4"
     mRNA            complement(join(273019..273069,273192..273305,
                     /gene_synonym="SCAR family protein 4"
                     /product="SCAR family protein 4"
     CDS             complement(join(273019..273069,273192..273305,
                     /gene_synonym="SCAR family protein 4"
                     /product="SCAR family protein 4"
     mRNA            complement(join(273165..273305,273389..273475,
                     /gene_synonym="SCAR family protein 4"
                     /product="SCAR family protein 4"
     mRNA            complement(join(273165..273305,273389..273475,
                     /gene_synonym="SCAR family protein 4"
                     /product="SCAR family protein 4"
     mRNA            complement(join(273165..273305,273389..273475,
                     /gene_synonym="SCAR family protein 4"
                     /product="SCAR family protein 4"
     CDS             complement(join(273165..273305,273389..273475,
                     /gene_synonym="SCAR family protein 4"
                     /product="SCAR family protein 4"
     CDS             complement(join(273165..273305,273389..273475,
                     /gene_synonym="SCAR family protein 4"
                     /product="SCAR family protein 4"
     CDS             complement(join(273165..273305,273389..273475,
                     /gene_synonym="SCAR family protein 4"
                     /product="SCAR family protein 4"
     mRNA            complement(join(273335..273475,273554..276179,
                     /gene_synonym="SCAR family protein 4"
                     /product="SCAR family protein 4"
     mRNA            complement(join(273335..273475,273554..276179,
                     /gene_synonym="SCAR family protein 4"
                     /product="SCAR family protein 4"
     CDS             complement(join(273335..273475,273554..276179,
                     /gene_synonym="SCAR family protein 4"
                     /product="SCAR family protein 4"
     CDS             complement(join(273335..273475,273554..276179,
                     /gene_synonym="SCAR family protein 4"
                     /product="SCAR family protein 4"
     gene            280674..281532
     mRNA            280674..281532
                     /product="Nuclear transport factor 2 (NTF2) family
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             280793..281281
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="Nuclear transport factor 2 (NTF2) family protein;
                     CONTAINS InterPro DOMAIN/s: Wound-induced protein, Wun1
                     (InterPro:IPR009798); BEST Arabidopsis thaliana protein
                     match is: senescence associated gene 20
                     (TAIR:AT3G10985.1); Has 1807 Blast hits to 1807 proteins
                     in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736;
                     Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes -
                     339 (source: NCBI BLink)."
                     /product="Nuclear transport factor 2 (NTF2) family
     gene            287584..287736
                     /gene_synonym="MICRORNA 164"
                     /note="Encodes a microRNA that targets several genes
                     containing NAC domains including NAC1. Overexpression
                     leads to decreased NAC1 mRNA and reduced lateral roots.
                     Loss of function mutants have increased NAC1 and increased
                     number of lateral roots. Also targets ORE1 to negatively
                     regulate the timing of leaf senescence. MicroRNAs are
                     regulatory RNAs with a mature length of
                     21-nucleotides that are processed from hairpin precursors
                     by Dicer-like enzymes. MicroRNAs can negatively regulate
                     gene expression by attenuating translation or by directing
                     mRNA cleavage.Mature sequence: UGGAGAAGCAGGGCACGUGCA"
     precursor_RNA   287584..287736
                     /gene_synonym="MICRORNA 164"
                     /product="microRNA ath-MIR164b precursor"
     ncRNA           287586..287606
                     /gene_synonym="MICRORNA 164"
                     /product="microRNA ath-miR164b-5p"
                     /note="mature miRNA accession:MIMAT0000186"
     ncRNA           287716..287736
                     /gene_synonym="MICRORNA 164"
                     /product="microRNA ath-miR164b-3p"
                     /note="mature miRNA accession:MIMAT0031878"
     gene            complement(288329..288574)
     ncRNA           complement(288329..288574)
                     /product="other RNA"
     gene            289717..291604