LOCUS       CP002684            30427671 bp    DNA     linear   PLN 20-JUL-2017
DEFINITION  Arabidopsis thaliana chromosome 1 sequence.
VERSION     CP002684.1
DBLINK      BioProject: PRJNA10719
            BioSample: SAMN03081427
SOURCE      Arabidopsis thaliana (thale cress)
  ORGANISM  Arabidopsis thaliana
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliophyta; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
            Camelineae; Arabidopsis.
REFERENCE   1  (bases 1 to 30427671)
  AUTHORS   Theologis,A., Ecker,J.R., Palm,C.J., Federspiel,N.A., Kaul,S.,
            White,O., Alonso,J., Altafi,H., Araujo,R., Bowman,C.L.,
            Brooks,S.Y., Buehler,E., Chan,A., Chao,Q., Chen,H., Cheuk,R.F.,
            Chin,C.W., Chung,M.K., Conn,L., Conway,A.B., Conway,A.R.,
            Creasy,T.H., Dewar,K., Dunn,P., Etgu,P., Feldblyum,T.V., Feng,J.,
            Fong,B., Fujii,C.Y., Gill,J.E., Goldsmith,A.D., Haas,B.,
            Hansen,N.F., Hughes,B., Huizar,L., Hunter,J.L., Jenkins,J.,
            Johnson-Hopson,C., Khan,S., Khaykin,E., Kim,C.J., Koo,H.L.,
            Kremenetskaia,I., Kurtz,D.B., Kwan,A., Lam,B., Langin-Hooper,S.,
            Lee,A., Lee,J.M., Lenz,C.A., Li,J.H., Li,Y., Lin,X., Liu,S.X.,
            Liu,Z.A., Luros,J.S., Maiti,R., Marziali,A., Militscher,J.,
            Miranda,M., Nguyen,M., Nierman,W.C., Osborne,B.I., Pai,G.,
            Peterson,J., Pham,P.K., Rizzo,M., Rooney,T., Rowley,D., Sakano,H.,
            Salzberg,S.L., Schwartz,J.R., Shinn,P., Southwick,A.M., Sun,H.,
            Tallon,L.J., Tambunga,G., Toriumi,M.J., Town,C.D., Utterback,T.,
            Van Aken,S., Vaysberg,M., Vysotskaia,V.S., Walker,M., Wu,D., Yu,G.,
            Fraser,C.M., Venter,J.C. and Davis,R.W.
  TITLE     Sequence and analysis of chromosome 1 of the plant Arabidopsis
  JOURNAL   Nature 408 (6814), 816-820 (2000)
   PUBMED   11130712
REFERENCE   2  (bases 1 to 30427671)
  AUTHORS   Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E.
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2011) Department of Plant Biology, Carnegie
            Institution, 260 Panama Street, Stanford, CA, USA
REFERENCE   3  (bases 1 to 30427671)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
REFERENCE   4  (bases 1 to 30427671)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (18-JUL-2017) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
FEATURES             Location/Qualifiers
     source          1..30427671
                     /organism="Arabidopsis thaliana"
                     /mol_type="genomic DNA"
     gene            3631..5899
                     /gene_synonym="NAC domain containing protein 1"
     mRNA            join(3631..3913,3996..4276,4486..4605,4706..5095,
                     /gene_synonym="NAC domain containing protein 1"
                     /product="NAC domain containing protein 1"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             join(3760..3913,3996..4276,4486..4605,4706..5095,
                     /gene_synonym="NAC domain containing protein 1"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="NAC domain containing protein 1 (NAC001); FUNCTIONS
                     IN: sequence-specific DNA binding transcription factor
                     activity; INVOLVED IN: multicellular organismal
                     development, regulation of transcription; LOCATED IN:
                     cellular_component unknown; EXPRESSED IN: 7 plant
                     structures; EXPRESSED DURING: 4 anthesis, C globular
                     stage, petal differentiation and expansion stage; CONTAINS
                     InterPro DOMAIN/s: No apical meristem (NAM) protein
                     (InterPro:IPR003441); BEST Arabidopsis thaliana protein
                     match is: NAC domain containing protein 69
                     (TAIR:AT4G01550.1); Has 2503 Blast hits to 2496 proteins
                     in 69 species: Archae - 0; Bacteria - 0; Metazoa - 0;
                     Fungi - 0; Plants - 2502; Viruses - 0; Other Eukaryotes -
                     1 (source: NCBI BLink)."
                     /product="NAC domain containing protein 1"
     gene            complement(6788..9130)
     mRNA            complement(join(6788..7069,7157..7232,7384..7450,
                     /product="ARV1 family protein"
     mRNA            complement(join(6788..7069,7157..7232,7384..7450,
                     /product="ARV1 family protein"
     mRNA            complement(join(6788..7069,7157..7232,7384..7450,
                     /product="ARV1 family protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AY758070.1"
     mRNA            complement(join(6788..7069,7157..7232,7384..7450,
                     /product="ARV1 family protein"
     mRNA            complement(join(6788..7069,7157..7450,7564..7649,
                     /product="ARV1 family protein"
     mRNA            complement(join(6788..7069,7157..7450,7564..7649,
                     /product="ARV1 family protein"
                     /inference="Similar to RNA sequence,
     CDS             complement(join(6915..7069,7157..7232,7384..7450,
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AY758070.1"
                     /note="ARV1; CONTAINS InterPro DOMAIN/s: Arv1-like protein
                     (InterPro:IPR007290); BEST Arabidopsis thaliana protein
                     match is: Arv1-like protein (TAIR:AT4G01510.1); Has 311
                     Blast hits to 311 proteins in 154 species: Archae - 0;
                     Bacteria - 0; Metazoa - 110; Fungi - 115; Plants - 42;
                     Viruses - 0; Other Eukaryotes - 44 (source: NCBI BLink)."
                     /product="ARV1 family protein"
     CDS             complement(join(6915..7069,7157..7232,7384..7450,
                     /product="ARV1 family protein"
     CDS             complement(join(6915..7069,7157..7232,7384..7450,
                     /product="ARV1 family protein"
     CDS             complement(join(6915..7069,7157..7232,7384..7450,
                     /product="ARV1 family protein"
     CDS             complement(join(7315..7450,7564..7649,7762..7835,
                     /inference="Similar to RNA sequence,
                     /note="ARV1; CONTAINS InterPro DOMAIN/s: Arv1-like protein
                     (InterPro:IPR007290); BEST Arabidopsis thaliana protein
                     match is: Arv1-like protein (TAIR:AT4G01510.1); Has 35333
                     Blast hits to 34131 proteins in 2444 species: Archae -
                     798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants
                     - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI
                     /product="ARV1 family protein"
     CDS             complement(join(7315..7450,7564..7649,8236..8325,
                     /product="ARV1 family protein"
     gene            11101..11372
     ncRNA           11101..11372
                     /product="other RNA"
     gene            complement(11649..13714)
     mRNA            complement(join(11649..12354,12424..13173,13335..13714))
                     /product="AP2/B3-like transcriptional factor family
     mRNA            complement(join(11649..13173,13335..13714))
                     /product="AP2/B3-like transcriptional factor family
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:BX814729.1"
     CDS             complement(join(11864..12354,12424..12940))
                     /product="AP2/B3-like transcriptional factor family
     CDS             complement(11864..12940)
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:BX814729.1"
                     /note="NGATHA3 (NGA3); CONTAINS InterPro DOMAIN/s:
                     Transcriptional factor B3 (InterPro:IPR003340); BEST
                     Arabidopsis thaliana protein match is: AP2/B3-like
                     transcriptional factor family protein (TAIR:AT4G01500.1);
                     Has 1380 Blast hits to 1379 proteins in 72 species: Archae
                     - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1380;
                     Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink)."
                     /product="AP2/B3-like transcriptional factor family
     gene            23121..31227
                     /gene_synonym="ABNORMAL SUSPENSOR 1"
                     /gene_synonym="CARPEL FACTORY"
                     /gene_synonym="dicer-like 1"
                     /gene_synonym="DICER-LIKE 1"
                     /gene_synonym="EMBRYO DEFECTIVE 60"
                     /gene_synonym="EMBRYO DEFECTIVE 76"
                     /gene_synonym="SHORT INTEGUMENTS 1"
                     /gene_synonym="SUSPENSOR 1"
                     /note="Encodes a Dicer homolog. Dicer is a RNA helicase
                     involved in microRNA processing. Mutations in this locus
                     can result in embryo lethality. Embryo shape at seed
                     maturity is globular-elongate. Other mutants convert the
                     floral meristems to an indeterminate state, others yet
                     show defects in ovule development. mRNA is expressed in
                     all shoot tissues. DCL1 is able to produce miRNAs and
     mRNA            join(23121..24451,24542..24655,24752..24962,25041..25435,
                     /gene_synonym="ABNORMAL SUSPENSOR 1"
                     /gene_synonym="CARPEL FACTORY"
                     /gene_synonym="dicer-like 1"
                     /gene_synonym="DICER-LIKE 1"
                     /gene_synonym="EMBRYO DEFECTIVE 60"
                     /gene_synonym="EMBRYO DEFECTIVE 76"
                     /gene_synonym="SHORT INTEGUMENTS 1"
                     /gene_synonym="SUSPENSOR 1"
                     /product="dicer-like 1"
     gene            complement(23312..24099)
                     /note="Natural antisense transcript overlaps with
     ncRNA           complement(23312..24099)
                     /product="other RNA"
     mRNA            join(23416..24451,24542..24655,24752..24962,25041..25435,
                     /gene_synonym="ABNORMAL SUSPENSOR 1"
                     /gene_synonym="CARPEL FACTORY"
                     /gene_synonym="dicer-like 1"
                     /gene_synonym="DICER-LIKE 1"
                     /gene_synonym="EMBRYO DEFECTIVE 60"
                     /gene_synonym="EMBRYO DEFECTIVE 76"
                     /gene_synonym="SHORT INTEGUMENTS 1"
                     /gene_synonym="SUSPENSOR 1"
                     /product="dicer-like 1"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             join(23519..24451,24542..24655,24752..24962,25041..25435,
                     /gene_synonym="ABNORMAL SUSPENSOR 1"
                     /gene_synonym="CARPEL FACTORY"
                     /gene_synonym="dicer-like 1"
                     /gene_synonym="DICER-LIKE 1"
                     /gene_synonym="EMBRYO DEFECTIVE 60"
                     /gene_synonym="EMBRYO DEFECTIVE 76"
                     /gene_synonym="SHORT INTEGUMENTS 1"
                     /gene_synonym="SUSPENSOR 1"
                     /note="dicer-like 1 (DCL1); CONTAINS InterPro DOMAIN/s:
                     Restriction endonuclease, type I, R subunit/Type III, Res
                     subunit (InterPro:IPR006935), Double-stranded RNA-binding
                     (InterPro:IPR001159), Argonaute/Dicer protein, PAZ
                     (InterPro:IPR003100), Ribonuclease III
                     (InterPro:IPR000999), Double-stranded RNA-binding-like
                     (InterPro:IPR014720), DEAD-like helicase, N-terminal
                     (InterPro:IPR014001), DNA/RNA helicase, C-terminal
                     (InterPro:IPR001650), Dicer double-stranded RNA-binding
                     fold (InterPro:IPR005034), Helicase, superfamily 1/2,
                     ATP-binding domain (InterPro:IPR014021); BEST Arabidopsis
                     thaliana protein match is: dicer-like 3
                     /product="dicer-like 1"
     CDS             join(23519..24451,24542..24655,24752..24962,25041..25435,
                     /gene_synonym="ABNORMAL SUSPENSOR 1"
                     /gene_synonym="CARPEL FACTORY"
                     /gene_synonym="dicer-like 1"
                     /gene_synonym="DICER-LIKE 1"
                     /gene_synonym="EMBRYO DEFECTIVE 60"
                     /gene_synonym="EMBRYO DEFECTIVE 76"
                     /gene_synonym="SHORT INTEGUMENTS 1"
                     /gene_synonym="SUSPENSOR 1"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="dicer-like 1 (DCL1); CONTAINS InterPro DOMAIN/s:
                     Restriction endonuclease, type I, R subunit/Type III, Res
                     subunit (InterPro:IPR006935), Double-stranded RNA-binding
                     (InterPro:IPR001159), Argonaute/Dicer protein, PAZ
                     (InterPro:IPR003100), Ribonuclease III
                     (InterPro:IPR000999), Double-stranded RNA-binding-like
                     (InterPro:IPR014720), DEAD-like helicase, N-terminal
                     (InterPro:IPR014001), DNA/RNA helicase, C-terminal
                     (InterPro:IPR001650), Helicase, superfamily 1/2,
                     ATP-binding domain (InterPro:IPR014021), Dicer
                     double-stranded RNA-binding fold (InterPro:IPR005034);
                     BEST Arabidopsis thaliana protein match is: dicer-like 3
                     (TAIR:AT3G43920.2); Has 21958 Blast hits to 17420 proteins
                     in 2982 species: Archae - 328; Bacteria - 11461; Metazoa -
                     3615; Fungi - 1668; Plants - 1373; Viruses - 45; Other
                     Eukaryotes - 3468 (source: NCBI BLink)."
                     /product="dicer-like 1"
     gene            28500..28706
                     /note="Encodes a microRNA of unknown function. MicroRNAs
                     are regulatory RNAs with a mature length of
                     21-nucleotides that are processed from hairpin precursors
                     by Dicer-like enzymes. MicroRNAs can negatively regulate
                     gene expression by attenuating translation or by directing
                     mRNA cleavage. Mature sequence: UUUUCUUCUACUUCUUGCACA"
     precursor_RNA   28500..28706
                     /product="microRNA ath-MIR838 precursor"
     ncRNA           28635..28655
                     /product="microRNA ath-miR838"
                     /note="mature miRNA accession:MIMAT0004260"
     gene            complement(31170..33171)
                     /gene_synonym="pyrophosphorylase 1"
                     /note="Encodes a soluble protein with inorganic
                     pyrophosphatase activity that is highly specific for
                     Mg-inorganic pyrophosphate."
     mRNA            complement(join(31170..31424,31521..31602,31693..31813,
                     /gene_synonym="pyrophosphorylase 1"
                     /product="pyrophosphorylase 1"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     mRNA            complement(join(31382..31424,31521..31602,31693..31813,
                     /gene_synonym="pyrophosphorylase 1"
                     /product="pyrophosphorylase 1"
     CDS             complement(join(31382..31424,31521..31602,31693..31813,
                     /gene_synonym="pyrophosphorylase 1"
                     /product="pyrophosphorylase 1"
     CDS             complement(join(31382..31424,31521..31602,31693..31813,
                     /gene_synonym="pyrophosphorylase 1"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="pyrophosphorylase 1 (PPa1); FUNCTIONS IN: inorganic
                     diphosphatase activity; INVOLVED IN: phosphate metabolic
                     process, metabolic process; LOCATED IN: nucleus, membrane,
                     cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED
                     DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s:
                     Inorganic pyrophosphatase (InterPro:IPR008162); BEST
                     Arabidopsis thaliana protein match is: pyrophosphorylase 3
                     (TAIR:AT2G46860.1); Has 5987 Blast hits to 5987 proteins
                     in 1845 species: Archae - 172; Bacteria - 4313; Metazoa -
                     247; Fungi - 261; Plants - 270; Viruses - 0; Other
                     Eukaryotes - 724 (source: NCBI BLink)."
                     /product="pyrophosphorylase 1"
     gene            32727..33009
                     /note="Natural antisense transcript overlaps with
     ncRNA           32727..33009
                     /product="other RNA"
     gene            complement(33365..37871)
                     /gene_synonym="LATE ELONGATED HYPOCOTYL"
                     /gene_synonym="LATE ELONGATED HYPOCOTYL 1"
                     /note="LHY encodes a myb-related putative transcription
                     factor involved in circadian rhythm along with another myb
                     transcription factor CCA1"
     mRNA            complement(join(33365..33589,33981..34327,34401..35474,
                     /gene_synonym="LATE ELONGATED HYPOCOTYL"
                     /gene_synonym="LATE ELONGATED HYPOCOTYL 1"
                     /product="Homeodomain-like superfamily protein"
     mRNA            complement(join(33379..33589,33981..34327,34401..35474,
                     /gene_synonym="LATE ELONGATED HYPOCOTYL"
                     /gene_synonym="LATE ELONGATED HYPOCOTYL 1"
                     /product="Homeodomain-like superfamily protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AY519507.1"
     mRNA            complement(join(33662..34327,34401..35474,35567..35647,
                     /gene_synonym="LATE ELONGATED HYPOCOTYL"
                     /gene_synonym="LATE ELONGATED HYPOCOTYL 1"
                     /product="Homeodomain-like superfamily protein"
     mRNA            complement(join(33662..34327,34401..35474,35567..35647,
                     /gene_synonym="LATE ELONGATED HYPOCOTYL"
                     /gene_synonym="LATE ELONGATED HYPOCOTYL 1"
                     /product="Homeodomain-like superfamily protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     mRNA            complement(join(33666..34327,34401..35471,35567..35647,
                     /gene_synonym="LATE ELONGATED HYPOCOTYL"
                     /gene_synonym="LATE ELONGATED HYPOCOTYL 1"
                     /product="Homeodomain-like superfamily protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AY519507.1"
     mRNA            complement(join(33666..34327,34401..35474,35567..35647,
                     /gene_synonym="LATE ELONGATED HYPOCOTYL"
                     /gene_synonym="LATE ELONGATED HYPOCOTYL 1"
                     /product="Homeodomain-like superfamily protein"
                     /inference="Similar to RNA sequence,
     mRNA            complement(join(33967..34327,34401..35474,35567..35647,
                     /gene_synonym="LATE ELONGATED HYPOCOTYL"
                     /gene_synonym="LATE ELONGATED HYPOCOTYL 1"
                     /product="Homeodomain-like superfamily protein"
     mRNA            complement(join(33967..34327,34401..35474,35567..35647,
                     /gene_synonym="LATE ELONGATED HYPOCOTYL"
                     /gene_synonym="LATE ELONGATED HYPOCOTYL 1"
                     /product="Homeodomain-like superfamily protein"
     CDS             complement(join(33992..34327,34401..35471,35567..35647,
                     /gene_synonym="LATE ELONGATED HYPOCOTYL"
                     /gene_synonym="LATE ELONGATED HYPOCOTYL 1"
                     /inference="Similar to RNA sequence,
                     /note="LATE ELONGATED HYPOCOTYL (LHY); CONTAINS InterPro
                     DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Myb,
                     DNA-binding (InterPro:IPR014778), Homeodomain-like
                     (InterPro:IPR009057), Myb-like DNA-binding domain, SHAQKYF
                     class (InterPro:IPR006447), HTH transcriptional regulator,
                     Myb-type, DNA-binding (InterPro:IPR017930); BEST
                     Arabidopsis thaliana protein match is: circadian clock
                     associated 1 (TAIR:AT2G46830.1); Has 2567 Blast hits to
                     2041 proteins in 275 species: Archae - 2; Bacteria - 252;
                     Metazoa - 294; Fungi - 166; Plants - 1044; Viruses - 30;
                     Other Eukaryotes - 779 (source: NCBI BLink)."
                     /product="Homeodomain-like superfamily protein"
     CDS             complement(join(33992..34327,34401..35474,35567..35647,
                     /gene_synonym="LATE ELONGATED HYPOCOTYL"
                     /gene_synonym="LATE ELONGATED HYPOCOTYL 1"
                     /product="Homeodomain-like superfamily protein"
     CDS             complement(join(33992..34327,34401..35474,35567..35647,
                     /gene_synonym="LATE ELONGATED HYPOCOTYL"
                     /gene_synonym="LATE ELONGATED HYPOCOTYL 1"
                     /product="Homeodomain-like superfamily protein"
     CDS             complement(join(33992..34327,34401..35474,35567..35647,
                     /gene_synonym="LATE ELONGATED HYPOCOTYL"
                     /gene_synonym="LATE ELONGATED HYPOCOTYL 1"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="LATE ELONGATED HYPOCOTYL (LHY); CONTAINS InterPro
                     DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005),
                     Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding
                     (InterPro:IPR014778), HTH transcriptional regulator,
                     Myb-type, DNA-binding (InterPro:IPR017930), Myb-like
                     DNA-binding domain, SHAQKYF class (InterPro:IPR006447);
                     BEST Arabidopsis thaliana protein match is: circadian
                     clock associated 1 (TAIR:AT2G46830.1); Has 2469 Blast hits
                     to 2022 proteins in 280 species: Archae - 2; Bacteria -
                     257; Metazoa - 292; Fungi - 162; Plants - 1048; Viruses -
                     29; Other Eukaryotes - 679 (source: NCBI BLink)."
                     /product="Homeodomain-like superfamily protein"
     CDS             complement(join(33992..34327,34401..35474,35567..35647,
                     /gene_synonym="LATE ELONGATED HYPOCOTYL"
                     /gene_synonym="LATE ELONGATED HYPOCOTYL 1"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AY519507.1"
                     /note="LATE ELONGATED HYPOCOTYL (LHY); CONTAINS InterPro
                     DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005),
                     Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding
                     (InterPro:IPR014778), HTH transcriptional regulator,
                     Myb-type, DNA-binding (InterPro:IPR017930), Myb-like
                     DNA-binding domain, SHAQKYF class (InterPro:IPR006447);
                     BEST Arabidopsis thaliana protein match is: circadian
                     clock associated 1 (TAIR:AT2G46830.1); Has 2469 Blast hits
                     to 2022 proteins in 280 species: Archae - 2; Bacteria -
                     257; Metazoa - 292; Fungi - 162; Plants - 1048; Viruses -
                     29; Other Eukaryotes - 679 (source: NCBI BLink)."
                     /product="Homeodomain-like superfamily protein"
     CDS             complement(join(33992..34327,34401..35474,35567..35647,
                     /gene_synonym="LATE ELONGATED HYPOCOTYL"
                     /gene_synonym="LATE ELONGATED HYPOCOTYL 1"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AY519507.1"
                     /note="LATE ELONGATED HYPOCOTYL (LHY); CONTAINS InterPro
                     DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005),
                     Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding
                     (InterPro:IPR014778), HTH transcriptional regulator,
                     Myb-type, DNA-binding (InterPro:IPR017930), Myb-like
                     DNA-binding domain, SHAQKYF class (InterPro:IPR006447);
                     BEST Arabidopsis thaliana protein match is: circadian
                     clock associated 1 (TAIR:AT2G46830.1); Has 35333 Blast
                     hits to 34131 proteins in 2444 species: Archae - 798;
                     Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants -
                     531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI
                     /product="Homeodomain-like superfamily protein"
     CDS             complement(join(33992..34327,34401..35474,35567..35647,
                     /gene_synonym="LATE ELONGATED HYPOCOTYL"
                     /gene_synonym="LATE ELONGATED HYPOCOTYL 1"
                     /product="Homeodomain-like superfamily protein"
     CDS             complement(join(33992..34327,34401..35474,35567..35647,
                     /gene_synonym="LATE ELONGATED HYPOCOTYL"
                     /gene_synonym="LATE ELONGATED HYPOCOTYL 1"
                     binding, sequence-specific DNA binding transcription
                     factor activity; INVOLVED IN: in 11 processes; EXPRESSED
                     IN: 22 plant structures; EXPRESSED DURING: 13 growth
                     stages; BEST Arabidopsis thaliana protein match is:
                     circadian clock associated 1 (TAIR:AT2G46830.1)."
                     /product="Homeodomain-like superfamily protein"
     gene            complement(38444..41017)
                     /gene_synonym="Usually multiple acids move in and out
                     Transporters 28"
                     /note="nodulin MtN21-like transporter family protein"
     mRNA            complement(join(38444..39054,39136..39287,39409..39814,
                     /gene_synonym="Usually multiple acids move in and out
                     Transporters 28"
                     /product="nodulin MtN21 /EamA-like transporter family
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     mRNA            complement(join(38752..39054,39136..39287,39409..39814,
                     /gene_synonym="Usually multiple acids move in and out
                     Transporters 28"
                     /product="nodulin MtN21 /EamA-like transporter family
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:BX816126.1"
     CDS             complement(join(38898..39054,39136..39287,39409..39814,
                     /gene_synonym="Usually multiple acids move in and out
                     Transporters 28"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="nodulin MtN21 /EamA-like transporter family
                     protein; LOCATED IN: membrane; EXPRESSED IN: 17 plant
                     structures; EXPRESSED DURING: 7 growth stages; CONTAINS
                     InterPro DOMAIN/s: Protein of unknown function DUF6,
                     transmembrane (InterPro:IPR000620); BEST Arabidopsis
                     thaliana protein match is: nodulin MtN21 /EamA-like
                     transporter family protein (TAIR:AT1G11460.1); Has 3211
                     Blast hits to 3199 proteins in 599 species: Archae - 23;
                     Bacteria - 1686; Metazoa - 4; Fungi - 6; Plants - 1233;
                     Viruses - 0; Other Eukaryotes - 259 (source: NCBI BLink)."
                     /product="nodulin MtN21 /EamA-like transporter family
     CDS             complement(join(38898..39054,39136..39287,39409..39814,
                     /gene_synonym="Usually multiple acids move in and out
                     Transporters 28"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:BX816126.1"
                     /note="nodulin MtN21 /EamA-like transporter family
                     protein; LOCATED IN: membrane; EXPRESSED IN: 17 plant
                     structures; EXPRESSED DURING: 7 growth stages; CONTAINS
                     InterPro DOMAIN/s: Protein of unknown function DUF6,
                     transmembrane (InterPro:IPR000620); BEST Arabidopsis
                     thaliana protein match is: nodulin MtN21 /EamA-like
                     transporter family protein (TAIR:AT1G11450.2); Has 35333
                     Blast hits to 34131 proteins in 2444 species: Archae -
                     798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants
                     - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI
                     /product="nodulin MtN21 /EamA-like transporter family
     gene            complement(43087..43295)
     ncRNA           complement(43087..43295)
                     /product="other RNA"
     gene            complement(44970..47059)
     mRNA            complement(join(44970..45559,45646..45954,46044..46145,
                     /product="RNA-binding (RRM/RBD/RNP motifs) family protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     mRNA            complement(join(44970..45954,46044..46145,46376..47059))
                     /product="RNA-binding (RRM/RBD/RNP motifs) family protein"
     mRNA            complement(join(45296..45559,45646..45954,46044..46145,
                     /product="RNA-binding (RRM/RBD/RNP motifs) family protein"
                     /inference="Similar to RNA sequence,
     CDS             complement(join(45503..45559,45646..45954,46044..46145,
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="RNA-binding (RRM/RBD/RNP motifs) family protein;
                     FUNCTIONS IN: RNA binding, nucleotide binding, nucleic
                     acid binding; INVOLVED IN: biological_process unknown;
                     LOCATED IN: chloroplast stroma, nucleus, chloroplast,
                     chloroplast envelope; EXPRESSED IN: 23 plant structures;
                     EXPRESSED DURING: 13 growth stages; CONTAINS InterPro
                     DOMAIN/s: RNA recognition motif, RNP-1
                     (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait
                     (InterPro:IPR012677); BEST Arabidopsis thaliana protein
                     match is: RNA-binding (RRM/RBD/RNP motifs) family protein
                     (TAIR:AT1G60000.1); Has 509067 Blast hits to 499893
                     proteins in 22124 species: Archae - 10819; Bacteria -
                     303967; Metazoa - 99035; Fungi - 14863; Plants - 31737;
                     Viruses - 35534; Other Eukaryotes - 13112 (source: NCBI
                     /product="RNA-binding (RRM/RBD/RNP motifs) family protein"
     CDS             complement(join(45503..45559,45646..45954,46044..46145,
                     /inference="Similar to RNA sequence,
                     /note="RNA-binding (RRM/RBD/RNP motifs) family protein;
                     FUNCTIONS IN: RNA binding, nucleotide binding, nucleic
                     acid binding; INVOLVED IN: biological_process unknown;
                     LOCATED IN: chloroplast; EXPRESSED IN: 23 plant
                     structures; EXPRESSED DURING: 13 growth stages; CONTAINS
                     InterPro DOMAIN/s: RNA recognition motif, RNP-1
                     (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait
                     (InterPro:IPR012677); BEST Arabidopsis thaliana protein
                     match is: RNA-binding (RRM/RBD/RNP motifs) family protein
                     (TAIR:AT1G60000.1); Has 35333 Blast hits to 34131 proteins
                     in 2444 species: Archae - 798; Bacteria - 22429; Metazoa -
                     974; Fungi - 991; Plants - 531; Viruses - 0; Other
                     Eukaryotes - 9610 (source: NCBI BLink)."
                     /product="RNA-binding (RRM/RBD/RNP motifs) family protein"
     CDS             complement(join(45610..45954,46044..46145,46376..46789))
                     /product="RNA-binding (RRM/RBD/RNP motifs) family protein"
     gene            complement(47234..49304)
                     /gene="PDH-E1 ALPHA"
                     /gene_synonym="pyruvate dehydrogenase E1 alpha"
                     /note="pyruvate dehydrogenase E1 alpha subunit"
     mRNA            complement(join(47234..47982,48075..48852,48936..49304))
                     /gene="PDH-E1 ALPHA"
                     /gene_synonym="pyruvate dehydrogenase E1 alpha"
                     /product="pyruvate dehydrogenase E1 alpha"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             complement(join(47705..47982,48075..48852,48936..49166))
                     /gene="PDH-E1 ALPHA"
                     /gene_synonym="pyruvate dehydrogenase E1 alpha"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="pyruvate dehydrogenase E1 alpha (PDH-E1 ALPHA);
                     FUNCTIONS IN: pyruvate dehydrogenase (acetyl-transferring)
                     activity; INVOLVED IN: oxidation reduction, glycolysis,
                     metabolic process; LOCATED IN: chloroplast, plastid,
                     chloroplast envelope; EXPRESSED IN: 25 plant structures;
                     EXPRESSED DURING: 15 growth stages; CONTAINS InterPro
                     DOMAIN/s: Dehydrogenase, E1 component
                     (InterPro:IPR001017), Pyruvate dehydrogenase
                     (acetyl-transferring) E1 component, alpha subunit,
                     subgroup y (InterPro:IPR017597); BEST Arabidopsis thaliana
                     protein match is: pyruvate dehydrogenase complex E1 alpha
                     subunit (TAIR:AT1G59900.1); Has 10065 Blast hits to 10059
                     proteins in 1888 species: Archae - 130; Bacteria - 6136;
                     Metazoa - 517; Fungi - 241; Plants - 224; Viruses - 0;
                     Other Eukaryotes - 2817 (source: NCBI BLink)."
                     /product="pyruvate dehydrogenase E1 alpha"
     gene            complement(49909..51210)
     mRNA            complement(join(49909..50337,50419..50631,50883..50963,
                     /product="60S acidic ribosomal protein family"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AY091176.1"
     mRNA            complement(join(50090..50337,50419..50447,50496..50631,
                     /product="60S acidic ribosomal protein family"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     mRNA            complement(join(50090..50337,50419..50631,50883..50963,
                     /product="60S acidic ribosomal protein family"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     mRNA            complement(join(50090..50337,50419..50631,50883..50963,
                     /product="60S acidic ribosomal protein family"
                     /inference="Similar to RNA sequence,
     CDS             complement(join(50284..50337,50419..50447,50496..50631,
                     /inference="Similar to RNA sequence,
                     /note="60S acidic ribosomal protein family; FUNCTIONS IN:
                     structural constituent of ribosome; INVOLVED IN:
                     translational elongation; LOCATED IN: cytosol, cytosolic
                     ribosome, ribosome, nucleus, plasma membrane; EXPRESSED
                     IN: 25 plant structures; EXPRESSED DURING: 14 growth
                     stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S
                     (InterPro:IPR001813); BEST Arabidopsis thaliana protein
                     match is: 60S acidic ribosomal protein family
                     (TAIR:AT5G47700.2); Has 1446 Blast hits to 1446 proteins
                     in 306 species: Archae - 3; Bacteria - 0; Metazoa - 542;
                     Fungi - 379; Plants - 324; Viruses - 0; Other Eukaryotes -
                     198 (source: NCBI BLink)."
                     /product="60S acidic ribosomal protein family"
     CDS             complement(join(50284..50337,50419..50631,50883..50954))
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="60S acidic ribosomal protein family; FUNCTIONS IN:
                     structural constituent of ribosome; INVOLVED IN:
                     translational elongation; LOCATED IN: cytosol, cytosolic
                     ribosome, ribosome, nucleus, plasma membrane; EXPRESSED
                     IN: 25 plant structures; EXPRESSED DURING: 14 growth
                     stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S
                     (InterPro:IPR001813); BEST Arabidopsis thaliana protein
                     match is: 60S acidic ribosomal protein family
                     (TAIR:AT5G47700.2); Has 2175 Blast hits to 2175 proteins
                     in 383 species: Archae - 76; Bacteria - 0; Metazoa - 858;
                     Fungi - 474; Plants - 451; Viruses - 0; Other Eukaryotes -
                     316 (source: NCBI BLink)."
                     /product="60S acidic ribosomal protein family"
     CDS             complement(join(50284..50337,50419..50631,50883..50954))
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="60S acidic ribosomal protein family; FUNCTIONS IN:
                     structural constituent of ribosome; INVOLVED IN:
                     translational elongation; LOCATED IN: cytosol, cytosolic
                     ribosome, ribosome, nucleus, plasma membrane; EXPRESSED
                     IN: 25 plant structures; EXPRESSED DURING: 14 growth
                     stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S
                     (InterPro:IPR001813); BEST Arabidopsis thaliana protein
                     match is: 60S acidic ribosomal protein family
                     (TAIR:AT5G47700.2); Has 2175 Blast hits to 2175 proteins
                     in 383 species: Archae - 76; Bacteria - 0; Metazoa - 858;
                     Fungi - 474; Plants - 451; Viruses - 0; Other Eukaryotes -
                     316 (source: NCBI BLink)."
                     /product="60S acidic ribosomal protein family"
     CDS             complement(join(50284..50337,50419..50631,50883..50954))
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AY091176.1"
                     /note="60S acidic ribosomal protein family; FUNCTIONS IN:
                     structural constituent of ribosome; INVOLVED IN:
                     translational elongation; LOCATED IN: cytosol, cytosolic
                     ribosome, ribosome, nucleus, plasma membrane; EXPRESSED
                     IN: 25 plant structures; EXPRESSED DURING: 14 growth
                     stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S
                     (InterPro:IPR001813); BEST Arabidopsis thaliana protein
                     match is: 60S acidic ribosomal protein family
                     (TAIR:AT5G47700.2); Has 2175 Blast hits to 2175 proteins
                     in 383 species: Archae - 76; Bacteria - 0; Metazoa - 858;
                     Fungi - 474; Plants - 451; Viruses - 0; Other Eukaryotes -
                     316 (source: NCBI BLink)."
                     /product="60S acidic ribosomal protein family"
     gene            51953..54737
                     /gene_synonym="IQ-domain 18"
     mRNA            join(51953..52346,52434..52730,52938..53183,53484..53624,
                     /gene_synonym="IQ-domain 18"
                     /product="IQ-domain 18"
                     /inference="Similar to RNA sequence,
     mRNA            join(52061..52730,52938..53183,53484..53624,53703..54689)
                     /gene_synonym="IQ-domain 18"
                     /product="IQ-domain 18"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AY085363.1"
     CDS             join(52239..52346,52434..52730,52938..53183,53484..53624,
                     /gene_synonym="IQ-domain 18"
                     /inference="Similar to RNA sequence,
                     /note="IQ-domain 18 (IQD18); FUNCTIONS IN:
                     molecular_function unknown; EXPRESSED IN: 10 plant
                     structures; EXPRESSED DURING: 6 growth stages; CONTAINS
                     InterPro DOMAIN/s: IQ calmodulin-binding region
                     (InterPro:IPR000048); BEST Arabidopsis thaliana protein
                     match is: IQ-domain 17 (TAIR:AT4G00820.1); Has 30201 Blast
                     hits to 17322 proteins in 780 species: Archae - 12;
                     Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants -
                     5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI
                     /product="IQ-domain 18"
     CDS             join(53022..53183,53484..53624,53703..54494)
                     /gene_synonym="IQ-domain 18"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AY085363.1"
                     /note="IQ-domain 18 (IQD18); FUNCTIONS IN:
                     molecular_function unknown; LOCATED IN: mitochondrion;
                     EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6
                     growth stages; BEST Arabidopsis thaliana protein match is:
                     IQ-domain 17 (TAIR:AT4G00820.1); Has 1112 Blast hits to
                     678 proteins in 50 species: Archae - 0; Bacteria - 10;
                     Metazoa - 109; Fungi - 16; Plants - 528; Viruses - 4;
                     Other Eukaryotes - 445 (source: NCBI BLink)."
                     /product="IQ-domain 18"
     gene            complement(57164..59215)
                     /gene_synonym="3-ketoacyl-CoA synthase 1"
                     /note="Encodes a condensing enzyme KCS1 (3-ketoacyl-CoA
                     synthase 1) which is involved in the critical fatty acid
                     elongation process in wax biosynthesis."
     mRNA            complement(57164..59215)
                     /gene_synonym="3-ketoacyl-CoA synthase 1"
                     /product="3-ketoacyl-CoA synthase 1"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             complement(57392..58978)
                     /gene_synonym="3-ketoacyl-CoA synthase 1"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="3-ketoacyl-CoA synthase 1 (KCS1); FUNCTIONS IN:
                     fatty acid elongase activity, acyltransferase activity;
                     INVOLVED IN: in 7 processes; LOCATED IN: cytosolic
                     ribosome, endoplasmic reticulum, membrane; EXPRESSED IN:
                     29 plant structures; EXPRESSED DURING: 13 growth stages;
                     CONTAINS InterPro DOMAIN/s: Thiolase-like
                     (InterPro:IPR016039), Very-long-chain 3-ketoacyl-CoA
                     synthase (InterPro:IPR012392),
                     3-Oxoacyl-[acyl-carrier-protein (ACP)] synthase III
                     C-terminal (InterPro:IPR013747), FAE1/Type III polyketide
                     synthase-like protein (InterPro:IPR013601), Thiolase-like,
                     subgroup (InterPro:IPR016038); BEST Arabidopsis thaliana
                     protein match is: 3-ketoacyl-CoA synthase 11
                     (TAIR:AT2G26640.1); Has 3961 Blast hits to 3946 proteins
                     in 966 species: Archae - 0; Bacteria - 1388; Metazoa - 0;
                     Fungi - 5; Plants - 2408; Viruses - 0; Other Eukaryotes -
                     160 (source: NCBI BLink)."
                     /product="3-ketoacyl-CoA synthase 1"
     gene            complement(61905..63811)
     mRNA            complement(join(61905..61949,62050..62124,63557..63811))
                     /product="CBL-interacting Serine/Threonine-kinase"
                     /inference="Similar to RNA sequence,
     CDS             complement(join(61905..61949,62050..62124,63557..63811))
                     /inference="Similar to RNA sequence,
                     /note="CONTAINS InterPro DOMAIN/s: CBL-interacting protein
                     kinase (InterPro:IPR020660), Calcium/calmodulin-dependent
                     protein kinase-like (InterPro:IPR020636); BEST Arabidopsis
                     thaliana protein match is: unknown protein
                     (TAIR:AT5G47170.1); Has 176 Blast hits to 176 proteins in
                     20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi -
                     0; Plants - 176; Viruses - 0; Other Eukaryotes - 0
                     (source: NCBI BLink)."
                     /product="CBL-interacting Serine/Threonine-kinase"
     gene            complement(64166..67774)
                     /gene_synonym="CBL-interacting protein kinase 9"
                     /gene_synonym="PROTEIN KINASE 6"
                     /gene_synonym="SNF1-RELATED PROTEIN KINASE 3.12"
                     /note="Encodes a CBL-interacting protein kinase with
                     similarity to SOS2"
     mRNA            complement(join(64166..64475,64582..64656,64751..64807,
                     /gene_synonym="CBL-interacting protein kinase 9"
                     /gene_synonym="PROTEIN KINASE 6"
                     /gene_synonym="SNF1-RELATED PROTEIN KINASE 3.12"
                     /product="CBL-interacting protein kinase 9"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     mRNA            complement(join(64167..64475,64570..64656,64751..64807,
                     /gene_synonym="CBL-interacting protein kinase 9"
                     /gene_synonym="PROTEIN KINASE 6"
                     /gene_synonym="SNF1-RELATED PROTEIN KINASE 3.12"
                     /product="CBL-interacting protein kinase 9"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AF339147.1"
     mRNA            complement(join(64167..64475,64582..64656,64751..64807,
                     /gene_synonym="CBL-interacting protein kinase 9"
                     /gene_synonym="PROTEIN KINASE 6"
                     /gene_synonym="SNF1-RELATED PROTEIN KINASE 3.12"
                     /product="CBL-interacting protein kinase 9"
                     /inference="Similar to RNA sequence,
     CDS             complement(join(64398..64475,64582..64656,64751..64807,
                     /gene_synonym="CBL-interacting protein kinase 9"
                     /gene_synonym="PROTEIN KINASE 6"
                     /gene_synonym="SNF1-RELATED PROTEIN KINASE 3.12"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="CBL-interacting protein kinase 9 (CIPK9); FUNCTIONS
                     IN: protein serine/threonine kinase activity, protein
                     kinase activity, kinase activity, ATP binding; INVOLVED
                     IN: in 6 processes; EXPRESSED IN: 23 plant structures;
                     EXPRESSED DURING: 15 growth stages; CONTAINS InterPro
                     DOMAIN/s: Protein kinase, ATP binding site
                     (InterPro:IPR017441), NAF/FISL domain
                     (InterPro:IPR018451), Serine/threonine-protein kinase
                     domain (InterPro:IPR002290), Serine/threonine-protein
                     kinase-like domain (InterPro:IPR017442), Protein
                     kinase-like domain (InterPro:IPR011009),
                     Serine/threonine-protein kinase, active site
                     (InterPro:IPR008271), CBL-interacting protein kinase
                     (InterPro:IPR020660), NAF domain (InterPro:IPR004041),
                     Protein kinase, catalytic domain (InterPro:IPR000719),
                     Calcium/calmodulin-dependent protein kinase-like
                     (InterPro:IPR020636), Tyrosine-protein kinase, catalytic
                     domain (InterPro:IPR020635); BEST Arabidopsis thaliana
                     protein match is: CBL-interacting protein kinase 23
                     (TAIR:AT1G30270.1); Has 130203 Blast hits to 128118
                     proteins in 4349 species: Archae - 165; Bacteria - 15262;
                     Metazoa - 47961; Fungi - 13206; Plants - 31482; Viruses -
                     522; Other Eukaryotes - 21605 (source: NCBI BLink)."
                     /product="CBL-interacting protein kinase 9"
     CDS             complement(join(64398..64475,64570..64656,64751..64807,
                     /gene_synonym="CBL-interacting protein kinase 9"
                     /gene_synonym="PROTEIN KINASE 6"
                     /gene_synonym="SNF1-RELATED PROTEIN KINASE 3.12"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AF339147.1"
                     /note="CBL-interacting protein kinase 9 (CIPK9); FUNCTIONS
                     IN: protein serine/threonine kinase activity, protein
                     kinase activity, kinase activity, ATP binding; INVOLVED
                     IN: in 6 processes; EXPRESSED IN: 23 plant structures;
                     EXPRESSED DURING: 15 growth stages; CONTAINS InterPro
                     DOMAIN/s: Protein kinase, ATP binding site
                     (InterPro:IPR017441), Serine/threonine-protein kinase
                     domain (InterPro:IPR002290), NAF/FISL domain
                     (InterPro:IPR018451), Serine/threonine-protein kinase-like
                     domain (InterPro:IPR017442), Protein kinase-like domain
                     (InterPro:IPR011009), Serine/threonine-protein kinase,
                     active site (InterPro:IPR008271), NAF domain
                     (InterPro:IPR004041), CBL-interacting protein kinase
                     (InterPro:IPR020660), Protein kinase, catalytic domain
                     (InterPro:IPR000719), Calcium/calmodulin-dependent protein
                     kinase-like (InterPro:IPR020636); BEST Arabidopsis
                     thaliana protein match is: CBL-interacting protein kinase
                     23 (TAIR:AT1G30270.1); Has 130572 Blast hits to 128490
                     proteins in 4426 species: Archae - 165; Bacteria - 15544;
                     Metazoa - 48044; Fungi - 13206; Plants - 31490; Viruses -
                     522; Other Eukaryotes - 21601 (source: NCBI BLink)."
                     /product="CBL-interacting protein kinase 9"
     CDS             complement(join(64398..64475,64582..64656,64751..64807,
                     /gene_synonym="CBL-interacting protein kinase 9"
                     /gene_synonym="PROTEIN KINASE 6"
                     /gene_synonym="SNF1-RELATED PROTEIN KINASE 3.12"
                     /inference="Similar to RNA sequence,
                     /note="CBL-interacting protein kinase 9 (CIPK9); FUNCTIONS
                     IN: protein serine/threonine kinase activity, protein
                     kinase activity, kinase activity, ATP binding; INVOLVED
                     IN: in 6 processes; EXPRESSED IN: 23 plant structures;
                     EXPRESSED DURING: 15 growth stages; CONTAINS InterPro
                     DOMAIN/s: Protein kinase, ATP binding site
                     (InterPro:IPR017441), Serine/threonine-protein kinase
                     domain (InterPro:IPR002290), NAF/FISL domain
                     (InterPro:IPR018451), Serine/threonine-protein kinase-like
                     domain (InterPro:IPR017442), Protein kinase-like domain
                     (InterPro:IPR011009), Serine/threonine-protein kinase,
                     active site (InterPro:IPR008271), NAF domain
                     (InterPro:IPR004041), CBL-interacting protein kinase
                     (InterPro:IPR020660), Protein kinase, catalytic domain
                     (InterPro:IPR000719), Calcium/calmodulin-dependent protein
                     kinase-like (InterPro:IPR020636); BEST Arabidopsis
                     thaliana protein match is: CBL-interacting protein kinase
                     23 (TAIR:AT1G30270.1); Has 130491 Blast hits to 128500
                     proteins in 4421 species: Archae - 165; Bacteria - 15543;
                     Metazoa - 48035; Fungi - 13165; Plants - 31462; Viruses -
                     522; Other Eukaryotes - 21599 (source: NCBI BLink)."
                     /product="CBL-interacting protein kinase 9"
     gene            complement(69911..72138)
     mRNA            complement(join(69911..70285,70840..70968,71041..71721,
                     /product="Homeodomain-like protein with RING/FYVE/PHD-type
                     zinc finger domain-containing protein"
                     /inference="Similar to RNA sequence,
     mRNA            complement(join(70035..70233,70896..70968,71041..71721,
                     /product="Homeodomain-like protein with RING/FYVE/PHD-type
                     zinc finger domain-containing protein"
     CDS             complement(join(70115..70233,70896..70968,71041..71721,
                     /product="Homeodomain-like protein with RING/FYVE/PHD-type
                     zinc finger domain-containing protein"
     CDS             complement(join(70115..70285,70840..70968,71041..71721,
                     /inference="Similar to RNA sequence,
                     /note="Homeodomain-like protein with RING/FYVE/PHD-type
                     zinc finger domain; FUNCTIONS IN: DNA binding, zinc ion
                     binding; INVOLVED IN: regulation of transcription;
                     EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4
                     anthesis, petal differentiation and expansion stage, E
                     expanded cotyledon stage, D bilateral stage; CONTAINS
                     InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057),
                     Zinc finger, PHD-type, conserved site
                     (InterPro:IPR019786), Zinc finger, FYVE/PHD-type
                     (InterPro:IPR011011), Homeodomain-related
                     (InterPro:IPR012287), MYB-like (InterPro:IPR017877); BEST
                     Arabidopsis thaliana protein match is: TRF-like 10
                     (TAIR:AT5G03780.1); Has 94 Blast hits to 77 proteins in 18
                     species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 0;
                     Plants - 86; Viruses - 0; Other Eukaryotes - 3 (source:
                     NCBI BLink)."
                     /product="Homeodomain-like protein with RING/FYVE/PHD-type
                     zinc finger domain-containing protein"
     mRNA            complement(join(70619..70968,71041..71721,71942..72138))
                     /product="Homeodomain-like protein with RING/FYVE/PHD-type
                     zinc finger domain-containing protein"
     CDS             complement(join(70828..70968,71041..71721,71942..71998))
                     /product="Homeodomain-like protein with RING/FYVE/PHD-type
                     zinc finger domain-containing protein"
     gene            72339..74096
                     /gene_synonym="GRF1-interacting factor 2"
                     /note="Arabidopsis thaliana GRF1-interacting factor 2
                     (GIF2) mRNA"
     mRNA            join(72339..72669,73087..73163,73287..73395,73488..73740,
                     /gene_synonym="GRF1-interacting factor 2"
                     /product="GRF1-interacting factor 2"
                     /inference="Similar to RNA sequence,
     mRNA            join(72357..72669,72915..73016,73087..73163,73287..73395,
                     /gene_synonym="GRF1-interacting factor 2"
                     /product="GRF1-interacting factor 2"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             join(72583..72669,72915..73016,73087..73163,73287..73395,
                     /gene_synonym="GRF1-interacting factor 2"
                     /inference="Similar to RNA sequence,
                     /note="GRF1-interacting factor 2 (GIF2); FUNCTIONS IN:
                     protein binding, transcription coactivator activity;
                     INVOLVED IN: cell proliferation, leaf development; LOCATED
                     IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED
                     DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SSXT
                     (InterPro:IPR007726); BEST Arabidopsis thaliana protein
                     match is: GRF1-interacting factor 3 (TAIR:AT4G00850.1);
                     Has 35 Blast hits to 35 proteins in 17 species: Archae -
                     0; Bacteria - 0; Metazoa - 12; Fungi - 5; Plants - 17;
                     Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink)."
                     /product="GRF1-interacting factor 2"
     CDS             join(72583..72669,73087..73163,73287..73395,73488..73740,
                     /gene_synonym="GRF1-interacting factor 2"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="GRF1-interacting factor 2 (GIF2); CONTAINS InterPro
                     DOMAIN/s: SSXT (InterPro:IPR007726); BEST Arabidopsis
                     thaliana protein match is: GRF1-interacting factor 3
                     (TAIR:AT4G00850.1); Has 425 Blast hits to 425 proteins in
                     91 species: Archae - 0; Bacteria - 4; Metazoa - 291; Fungi
                     - 20; Plants - 89; Viruses - 0; Other Eukaryotes - 21
                     (source: NCBI BLink)."
                     /product="GRF1-interacting factor 2"
     gene            complement(72646..73108)
                     /note="Natural antisense transcript overlaps with
     ncRNA           complement(72646..73108)
                     /product="other RNA"
     gene            complement(73931..74737)
     mRNA            complement(join(73931..74250,74338..74455,74661..74737))
                     /product="ozone-responsive stress-like protein (DUF1138)"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     mRNA            complement(join(73931..74250,74338..74449,74661..74731))
                     /product="ozone-responsive stress-like protein (DUF1138)"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:BT024529.1"
     CDS             complement(join(74105..74250,74338..74443))
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="Protein of unknown function (DUF1138); FUNCTIONS
                     IN: molecular_function unknown; INVOLVED IN: response to
                     stress; LOCATED IN: mitochondrion, membrane; EXPRESSED IN:
                     23 plant structures; EXPRESSED DURING: 13 growth stages;
                     CONTAINS InterPro DOMAIN/s: Protein of unknown function
                     DUF1138 (InterPro:IPR009515); BEST Arabidopsis thaliana
                     protein match is: Protein of unknown function (DUF1138)
                     (TAIR:AT4G00860.1); Has 86 Blast hits to 86 proteins in 15
                     species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0;
                     Plants - 86; Viruses - 0; Other Eukaryotes - 0 (source:
                     NCBI BLink)."
                     /product="ozone-responsive stress-like protein (DUF1138)"
     CDS             complement(join(74105..74250,74338..74443))
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:BT024529.1"
                     /note="Protein of unknown function (DUF1138); FUNCTIONS
                     IN: molecular_function unknown; INVOLVED IN: response to
                     stress; LOCATED IN: membrane; EXPRESSED IN: 23 plant
                     structures; EXPRESSED DURING: 13 growth stages; CONTAINS
                     InterPro DOMAIN/s: Protein of unknown function DUF1138
                     (InterPro:IPR009515); BEST Arabidopsis thaliana protein
                     match is: Protein of unknown function (DUF1138)
                     (TAIR:AT4G00860.1); Has 35333 Blast hits to 34131 proteins
                     in 2444 species: Archae - 798; Bacteria - 22429; Metazoa -
                     974; Fungi - 991; Plants - 531; Viruses - 0; Other
                     Eukaryotes - 9610 (source: NCBI BLink)."
                     /product="ozone-responsive stress-like protein (DUF1138)"
     gene            74435..74683
                     /note="Natural antisense transcript overlaps with
     ncRNA           74435..74683
                     /product="other RNA"
     gene            75390..76845
     mRNA            75390..76845
                     methyltransferases superfamily protein"
                     /inference="Similar to RNA sequence,
     CDS             75633..76556
                     /inference="Similar to RNA sequence,
                     methyltransferases superfamily protein; FUNCTIONS IN:
                     methyltransferase activity; INVOLVED IN: lipid
                     biosynthetic process; EXPRESSED IN: sperm cell, hypocotyl;
                     CONTAINS InterPro DOMAIN/s: Rhamnosyl
                     O-methyltransferase/Cephalosporin hydroxylase
                     (InterPro:IPR007072); Has 274 Blast hits to 274 proteins
                     in 51 species: Archae - 0; Bacteria - 75; Metazoa - 2;
                     Fungi - 0; Plants - 46; Viruses - 0; Other Eukaryotes -
                     151 (source: NCBI BLink)."
                     methyltransferases superfamily protein"
     gene            77537..80345
     misc_RNA        join(77537..78089,79097..80345)
                     /note="novel transcribed region;
     misc_RNA        join(77727..77892,78008..78089,79097..79340)
                     /note="novel transcribed region;
     gene            complement(78927..79037)
                     /gene_synonym="MICRORNA 165"
                     /note="Encodes a microRNA that targets several HD-ZIPIII
                     family members including PHV, PHB, REV, ATHB-8, and
                     ATHB-15. MicroRNAs are regulatory RNAs with a mature
                     length of
                     21-nucleotides that are processed from hairpin precursors
                     by Dicer-like enzymes. MicroRNAs can negatively regulate
                     gene expression by attenuating translation or by directing
                     mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUCCCC"
     precursor_RNA   complement(78927..79037)
                     /gene_synonym="MICRORNA 165"
                     /product="microRNA ath-MIR165a precursor"
     ncRNA           complement(78932..78952)
                     /gene_synonym="MICRORNA 165"
                     /product="microRNA ath-miR165a-3p"
                     /note="mature miRNA accession:MIMAT0000187"
     ncRNA           complement(79010..79030)
                     /gene_synonym="MICRORNA 165"
                     /product="microRNA ath-miR165a-5p"
                     /note="mature miRNA accession:MIMAT0031879"
     gene            complement(82984..84946)
                     /gene_synonym="''cytochrome P450"
                     /gene_synonym="cytochrome P450"
                     /gene_synonym="family 78"
                     /gene_synonym="polypeptide 8"
                     /gene_synonym="polypeptide 8''"
                     /gene_synonym="subfamily A"
                     /note="member of CYP78A"
     mRNA            complement(join(82984..83671,83884..84864))
                     /gene_synonym="''cytochrome P450"
                     /gene_synonym="cytochrome P450"
                     /gene_synonym="family 78"
                     /gene_synonym="polypeptide 8"
                     /gene_synonym="polypeptide 8''"
                     /gene_synonym="subfamily A"
                     /product="cytochrome P450, family 78, subfamily A,
                     polypeptide 8"
                     /inference="Similar to RNA sequence,
     mRNA            complement(join(83045..83671,83884..84946))
                     /gene_synonym="''cytochrome P450"
                     /gene_synonym="cytochrome P450"
                     /gene_synonym="family 78"
                     /gene_synonym="polypeptide 8"
                     /gene_synonym="polypeptide 8''"
                     /gene_synonym="subfamily A"
                     /product="cytochrome P450, family 78, subfamily A,
                     polypeptide 8"
     CDS             complement(join(83045..83671,83884..84879))
                     /gene_synonym="''cytochrome P450"
                     /gene_synonym="cytochrome P450"
                     /gene_synonym="family 78"
                     /gene_synonym="polypeptide 8"
                     /gene_synonym="polypeptide 8''"
                     /gene_synonym="subfamily A"
                     /product="cytochrome P450, family 78, subfamily A,
                     polypeptide 8"
     CDS             complement(join(83045..83671,83884..84864))
                     /gene_synonym="''cytochrome P450"
                     /gene_synonym="cytochrome P450"
                     /gene_synonym="family 78"
                     /gene_synonym="polypeptide 8"
                     /gene_synonym="polypeptide 8''"
                     /gene_synonym="subfamily A"
                     /inference="Similar to RNA sequence,
                     /note="''cytochrome P450, family 78, subfamily A,
                     polypeptide 8'' (CYP78A8); FUNCTIONS IN: electron carrier
                     activity, monooxygenase activity, iron ion binding, oxygen
                     binding, heme binding; INVOLVED IN: oxidation reduction;
                     LOCATED IN: endomembrane system; EXPRESSED IN: 6 plant
                     structures; EXPRESSED DURING: LP.10 ten leaves visible,
                     LP.02 two leaves visible, LP.12 twelve leaves visible;
                     CONTAINS InterPro DOMAIN/s: Cytochrome P450
                     (InterPro:IPR001128), Cytochrome P450, conserved site
                     (InterPro:IPR017972), Cytochrome P450, E-class, group I
                     (InterPro:IPR002401); BEST Arabidopsis thaliana protein
                     match is: cytochrome P450, family 78, subfamily A,
                     polypeptide 6 (TAIR:AT2G46660.1); Has 32104 Blast hits to
                     32001 proteins in 1725 species: Archae - 48; Bacteria -
                     3617; Metazoa - 11430; Fungi - 6777; Plants - 9112;
                     Viruses - 3; Other Eukaryotes - 1117 (source: NCBI
                     /product="cytochrome P450, family 78, subfamily A,
                     polypeptide 8"
     gene            complement(86486..88409)
                     /gene_synonym="ARABIDOPSIS RAB GTPASE HOMOLOG A3"
                     /gene_synonym="RAB GTPase homolog A3"
     mRNA            complement(join(86486..87162,87880..88409))
                     /gene_synonym="ARABIDOPSIS RAB GTPASE HOMOLOG A3"
                     /gene_synonym="RAB GTPase homolog A3"
                     /product="RAB GTPase homolog A3"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             complement(join(86715..87162,87880..88145))
                     /gene_synonym="ARABIDOPSIS RAB GTPASE HOMOLOG A3"
                     /gene_synonym="RAB GTPase homolog A3"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="RAB GTPase homolog A3 (RABA3); FUNCTIONS IN: GTP
                     binding; INVOLVED IN: protein transport, small GTPase
                     mediated signal transduction; LOCATED IN: endosome,
                     nucleus, cell plate; EXPRESSED IN: lateral root cap,
                     hypocotyl, root, flower, epidermis; EXPRESSED DURING:
                     petal differentiation and expansion stage; CONTAINS
                     InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small
                     GTP-binding protein (InterPro:IPR005225), Small GTPase
                     (InterPro:IPR020851), Ras (InterPro:IPR013753), Ras small
                     GTPase, Rab type (InterPro:IPR003579), Rab11-related
                     (InterPro:IPR015595); BEST Arabidopsis thaliana protein
                     match is: RAB GTPase homolog A4C (TAIR:AT5G47960.1); Has
                     27164 Blast hits to 27137 proteins in 734 species: Archae
                     - 19; Bacteria - 134; Metazoa - 14292; Fungi - 3779;
                     Plants - 3194; Viruses - 20; Other Eukaryotes - 5726
                     (source: NCBI BLink)."
                     /product="RAB GTPase homolog A3"
     gene            88622..90502
     mRNA            join(88622..88730,88954..89081,89173..89263,89405..89745)
                     /product="DNA-directed RNA polymerase, subunit M,
     mRNA            join(88883..89081,89173..89263,89405..89579,90162..90502)
                     /product="DNA-directed RNA polymerase, subunit M,
     mRNA            join(88890..89081,89173..89263,89405..89745)
                     /product="DNA-directed RNA polymerase, subunit M,
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             join(88977..89081,89173..89263,89405..89529)
                     /product="DNA-directed RNA polymerase, subunit M,
     CDS             join(88977..89081,89173..89263,89405..89529)
                     /product="DNA-directed RNA polymerase, subunit M,
     CDS             join(88977..89081,89173..89263,89405..89529)
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="DNA-directed RNA polymerase, subunit M, archaeal;
                     FUNCTIONS IN: in 6 functions; INVOLVED IN: RNA elongation,
                     regulation of transcription, DNA-dependent, transcription,
                     regulation of transcription; LOCATED IN: nucleus; CONTAINS
                     InterPro DOMAIN/s: Zinc finger, TFIIS-type
                     (InterPro:IPR001222), DNA-directed RNA polymerase, M/15kDa
                     subunit (InterPro:IPR001529), DNA-directed RNA polymerase,
                     subunit M, archaeal (InterPro:IPR006288), DNA-directed RNA
                     polymerase M, 15kDa subunit, conserved site
                     (InterPro:IPR019761); BEST Arabidopsis thaliana protein
                     match is: DNA-directed RNA polymerase, subunit M, archaeal
                     (TAIR:AT4G07950.1); Has 1129 Blast hits to 1129 proteins
                     in 326 species: Archae - 242; Bacteria - 0; Metazoa - 276;
                     Fungi - 294; Plants - 112; Viruses - 0; Other Eukaryotes -
                     205 (source: NCBI BLink)."
                     /product="DNA-directed RNA polymerase, subunit M,
     gene            complement(90169..90401)
     ncRNA           complement(90169..90401)
                     /product="other RNA"
     gene            91342..95681
                     /gene_synonym="Arabidopsis thaliana
                     L-fucokinase/GDP-L-fucose pyrophosphorylase"
                     /note="Encodes a bifunctional enzyme that has both
                     L-fucokinase and GDP-L-fucose pyrophosphorylase
                     activities. It catalyzes the two steps of the L-fucose
                     salvage pathway for the generation of activated
                     GDP-L-fucose. This pathway seems to be of minor importance
                     for cell wall polysaccharide biosynthesis compared to the
                     de novo GDP-L-fucose biosynthesis pathway in Arabidopsis."
     mRNA            join(91342..91633,91743..92933,93045..93171,93271..94281,
                     /gene_synonym="Arabidopsis thaliana
                     L-fucokinase/GDP-L-fucose pyrophosphorylase"
                     /product="L-fucokinase/GDP-L-fucose pyrophosphorylase"
     mRNA            join(91342..91633,91743..92501,92569..92933,93045..93171,
                     /gene_synonym="Arabidopsis thaliana
                     L-fucokinase/GDP-L-fucose pyrophosphorylase"
                     /product="L-fucokinase/GDP-L-fucose pyrophosphorylase"
     mRNA            join(91342..91633,91743..92089,92270..92501,92569..92933,
                     /gene_synonym="Arabidopsis thaliana
                     L-fucokinase/GDP-L-fucose pyrophosphorylase"
                     /product="L-fucokinase/GDP-L-fucose pyrophosphorylase"
     mRNA            join(91342..91633,91743..92070,92270..92501,92569..92933,
                     /gene_synonym="Arabidopsis thaliana
                     L-fucokinase/GDP-L-fucose pyrophosphorylase"
                     /product="L-fucokinase/GDP-L-fucose pyrophosphorylase"
                     /inference="Similar to RNA sequence,
     gene            complement(91356..91685)
     ncRNA           complement(91356..91685)
                     /product="other RNA"
     mRNA            join(91376..91633,91743..92089,92270..92933,93045..93171,
                     /gene_synonym="Arabidopsis thaliana
                     L-fucokinase/GDP-L-fucose pyrophosphorylase"
                     /product="L-fucokinase/GDP-L-fucose pyrophosphorylase"
     mRNA            join(91376..91633,91743..92070,92270..92933,93045..93171,
                     /gene_synonym="Arabidopsis thaliana
                     L-fucokinase/GDP-L-fucose pyrophosphorylase"
                     /product="L-fucokinase/GDP-L-fucose pyrophosphorylase"
     mRNA            join(91642..92070,92270..92501,92569..92933,93045..93171,
                     /gene_synonym="Arabidopsis thaliana
                     L-fucokinase/GDP-L-fucose pyrophosphorylase"
                     /product="L-fucokinase/GDP-L-fucose pyrophosphorylase"
     mRNA            join(91692..92501,92569..92933,93045..93171,93271..94281,
                     /gene_synonym="Arabidopsis thaliana
                     L-fucokinase/GDP-L-fucose pyrophosphorylase"
                     /product="L-fucokinase/GDP-L-fucose pyrophosphorylase"
     CDS             join(91750..92070,92270..92501,92569..92933,93045..93171,
                     /gene_synonym="Arabidopsis thaliana
                     L-fucokinase/GDP-L-fucose pyrophosphorylase"
                     /product="L-fucokinase/GDP-L-fucose pyrophosphorylase"
     CDS             join(91750..92070,92270..92501,92569..92933,93045..93171,
                     /gene_synonym="Arabidopsis thaliana
                     L-fucokinase/GDP-L-fucose pyrophosphorylase"
                     /inference="Similar to RNA sequence,
                     /note="L-fucokinase/GDP-L-fucose pyrophosphorylase (FKGP);
                     FUNCTIONS IN: fucose-1-phosphate guanylyltransferase
                     activity, fucokinase activity, ATP binding, galactokinase
                     activity; INVOLVED IN: GDP-L-fucose salvage; LOCATED IN:
                     cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED
                     DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s:
                     Mevalonate/galactokinase (InterPro:IPR006206), Ribosomal
                     protein S5 domain 2-type fold (InterPro:IPR020568), GHMP
                     kinase (InterPro:IPR006204), L-fucokinase
                     (InterPro:IPR012887), Ribosomal protein S5 domain 2-type
                     fold, subgroup (InterPro:IPR014721), GHMP kinase,
                     C-terminal (InterPro:IPR013750); Has 1878 Blast hits to
                     1819 proteins in 539 species: Archae - 59; Bacteria - 918;
                     Metazoa - 155; Fungi - 3; Plants - 87; Viruses - 3; Other
                     Eukaryotes - 653 (source: NCBI BLink)."
                     /product="L-fucokinase/GDP-L-fucose pyrophosphorylase"
     CDS             join(92246..92501,92569..92933,93045..93171,93271..94281,
                     /gene_synonym="Arabidopsis thaliana
                     L-fucokinase/GDP-L-fucose pyrophosphorylase"
                     /product="L-fucokinase/GDP-L-fucose pyrophosphorylase"
     CDS             join(92246..92501,92569..92933,93045..93171,93271..94281,
                     /gene_synonym="Arabidopsis thaliana
                     L-fucokinase/GDP-L-fucose pyrophosphorylase"
                     /product="L-fucokinase/GDP-L-fucose pyrophosphorylase"
     CDS             join(92270..92501,92569..92933,93045..93171,93271..94281,
                     /gene_synonym="Arabidopsis thaliana
                     L-fucokinase/GDP-L-fucose pyrophosphorylase"
                     /product="L-fucokinase/GDP-L-fucose pyrophosphorylase"
     CDS             join(92583..92933,93045..93171,93271..94281,94357..95075,
                     /gene_synonym="Arabidopsis thaliana
                     L-fucokinase/GDP-L-fucose pyrophosphorylase"
                     /product="L-fucokinase/GDP-L-fucose pyrophosphorylase"
     CDS             join(92583..92933,93045..93171,93271..94281,94357..95075,
                     /gene_synonym="Arabidopsis thaliana
                     L-fucokinase/GDP-L-fucose pyrophosphorylase"
                     /product="L-fucokinase/GDP-L-fucose pyrophosphorylase"
     CDS             join(92583..92933,93045..93171,93271..94281,94357..95075,
                     /gene_synonym="Arabidopsis thaliana
                     L-fucokinase/GDP-L-fucose pyrophosphorylase"
                     /product="L-fucokinase/GDP-L-fucose pyrophosphorylase"
     gene            95935..97407
     mRNA            join(95935..96157,96554..97407)
                     /product="NC domain-containing protein-like protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             join(96064..96157,96554..97242)
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="NC domain-containing protein-related; CONTAINS
                     InterPro DOMAIN/s: NC (InterPro:IPR007053); BEST
                     Arabidopsis thaliana protein match is: NC
                     domain-containing protein-related (TAIR:AT4G00905.1); Has
                     173 Blast hits to 172 proteins in 34 species: Archae - 0;
                     Bacteria - 24; Metazoa - 5; Fungi - 0; Plants - 139;
                     Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink)."
                     /product="NC domain-containing protein-like protein"
     gene            97412..99240
     mRNA            join(97412..97805,98457..98605,98908..99240)
                     /product="ORMDL family protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             join(97620..97805,98457..98605,98908..99046)
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="ORMDL family protein; FUNCTIONS IN:
                     molecular_function unknown; INVOLVED IN: protein folding;
                     LOCATED IN: integral to membrane, endoplasmic reticulum;
                     EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15
                     growth stages; CONTAINS InterPro DOMAIN/s: ORMDL
                     (InterPro:IPR007203); BEST Arabidopsis thaliana protein
                     match is: ORMDL family protein (TAIR:AT5G42000.1); Has 538
                     Blast hits to 538 proteins in 163 species: Archae - 0;
                     Bacteria - 0; Metazoa - 276; Fungi - 148; Plants - 90;
                     Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink)."
                     /product="ORMDL family protein"
     gene            99865..101987
     mRNA            join(99865..100031,100111..100220,100657..101840)
                     /product="transmembrane protein"
     mRNA            99866..101987
                     /product="transmembrane protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     mRNA            join(99866..100220,100657..101987)
                     /product="transmembrane protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     mRNA            join(99866..100031,100657..101987)
                     /product="transmembrane protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AY091196.1"
     mRNA            join(99872..100031,100111..101882)
                     /product="transmembrane protein"
     CDS             100683..101678
                     /product="transmembrane protein"
     CDS             100683..101678
                     /product="transmembrane protein"
     CDS             100683..101678
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="unknown protein; INVOLVED IN: N-terminal protein
                     myristoylation; EXPRESSED IN: 17 plant structures;
                     EXPRESSED DURING: 11 growth stages; BEST Arabidopsis
                     thaliana protein match is: unknown protein
                     (TAIR:AT2G46550.1); Has 95 Blast hits to 78 proteins in 16
                     species: Archae - 0; Bacteria - 2; Metazoa - 11; Fungi -
                     0; Plants - 80; Viruses - 0; Other Eukaryotes - 2 (source:
                     NCBI BLink)."
                     /product="transmembrane protein"
     CDS             100683..101678
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="unknown protein; BEST Arabidopsis thaliana protein
                     match is: unknown protein (TAIR:AT2G46550.1); Has 35333
                     Blast hits to 34131 proteins in 2444 species: Archae -
                     798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants
                     - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI
                     /product="transmembrane protein"
     CDS             100683..101678
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AY091196.1"
                     /note="unknown protein; BEST Arabidopsis thaliana protein
                     match is: unknown protein (TAIR:AT2G46550.1); Has 35333
                     Blast hits to 34131 proteins in 2444 species: Archae -
                     798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants
                     - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI
                     /product="transmembrane protein"
     gene            complement(104440..105330)
                     /note="encodes a member of the DREB subfamily A-4 of
                     ERF/AP2 transcription factor family. The protein contains
                     one AP2 domain. There are 17 members in this subfamily
                     including TINY."
     mRNA            complement(104440..105330)
                     /product="Integrase-type DNA-binding superfamily protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             complement(104731..105309)
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="Integrase-type DNA-binding superfamily protein;
                     FUNCTIONS IN: DNA binding, sequence-specific DNA binding
                     transcription factor activity; INVOLVED IN: regulation of
                     transcription, DNA-dependent; LOCATED IN: nucleus,
                     chloroplast; EXPRESSED IN: 10 plant structures; EXPRESSED
                     DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s:
                     DNA-binding, integrase-type (InterPro:IPR016177),
                     Pathogenesis-related transcriptional factor/ERF,
                     DNA-binding (InterPro:IPR001471); BEST Arabidopsis
                     thaliana protein match is: Integrase-type DNA-binding
                     superfamily protein (TAIR:AT5G25810.1); Has 5404 Blast
                     hits to 5361 proteins in 232 species: Archae - 0; Bacteria
                     - 0; Metazoa - 0; Fungi - 0; Plants - 5399; Viruses - 0;
                     Other Eukaryotes - 5 (source: NCBI BLink)."
                     /product="Integrase-type DNA-binding superfamily protein"
     gene            108946..111699
                     /gene_synonym="Jasmonate Associated MYC2 LIKE 2"
     mRNA            join(108946..109330,109406..111699)
                     /gene_synonym="Jasmonate Associated MYC2 LIKE 2"
                     /product="basic helix-loop-helix (bHLH) DNA-binding
                     superfamily protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     mRNA            108991..111699
                     /gene_synonym="Jasmonate Associated MYC2 LIKE 2"
                     /product="basic helix-loop-helix (bHLH) DNA-binding
                     superfamily protein"
     mRNA            join(109076..109330,109413..111535)
                     /gene_synonym="Jasmonate Associated MYC2 LIKE 2"
                     /product="basic helix-loop-helix (bHLH) DNA-binding
                     superfamily protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             109595..111367
                     /gene_synonym="Jasmonate Associated MYC2 LIKE 2"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="basic helix-loop-helix (bHLH) DNA-binding
                     superfamily protein; FUNCTIONS IN: DNA binding,
                     sequence-specific DNA binding transcription factor
                     activity; INVOLVED IN: regulation of transcription;
                     LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures;
                     EXPRESSED DURING: 15 growth stages; CONTAINS InterPro
                     DOMAIN/s: Helix-loop-helix DNA-binding domain
                     (InterPro:IPR001092), Helix-loop-helix DNA-binding
                     (InterPro:IPR011598); BEST Arabidopsis thaliana protein
                     match is: ABA-inducible BHLH-type transcription factor
                     (TAIR:AT2G46510.1); Has 3647 Blast hits to 3273 proteins
                     in 223 species: Archae - 0; Bacteria - 2; Metazoa - 174;
                     Fungi - 93; Plants - 3336; Viruses - 0; Other Eukaryotes -
                     42 (source: NCBI BLink)."
                     /product="basic helix-loop-helix (bHLH) DNA-binding
                     superfamily protein"
     CDS             109595..111367
                     /gene_synonym="Jasmonate Associated MYC2 LIKE 2"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="basic helix-loop-helix (bHLH) DNA-binding
                     superfamily protein; FUNCTIONS IN: DNA binding,
                     sequence-specific DNA binding transcription factor
                     activity; INVOLVED IN: regulation of transcription;
                     LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures;
                     EXPRESSED DURING: 15 growth stages; CONTAINS InterPro
                     DOMAIN/s: Helix-loop-helix DNA-binding domain
                     (InterPro:IPR001092), Helix-loop-helix DNA-binding
                     (InterPro:IPR011598); BEST Arabidopsis thaliana protein
                     match is: ABA-inducible BHLH-type transcription factor
                     (TAIR:AT2G46510.1); Has 3647 Blast hits to 3273 proteins
                     in 223 species: Archae - 0; Bacteria - 2; Metazoa - 174;
                     Fungi - 93; Plants - 3336; Viruses - 0; Other Eukaryotes -
                     42 (source: NCBI BLink)."
                     /product="basic helix-loop-helix (bHLH) DNA-binding
                     superfamily protein"
     CDS             109595..111367
                     /gene_synonym="Jasmonate Associated MYC2 LIKE 2"
                     /note="basic helix-loop-helix (bHLH) DNA-binding
                     superfamily protein; FUNCTIONS IN: DNA binding,
                     sequence-specific DNA binding transcription factor
                     activity; INVOLVED IN: regulation of transcription;
                     LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures;
                     EXPRESSED DURING: 15 growth stages; CONTAINS InterPro
                     DOMAIN/s: Helix-loop-helix DNA-binding domain
                     (InterPro:IPR001092), Helix-loop-helix DNA-binding
                     (InterPro:IPR011598); BEST Arabidopsis thaliana protein
                     match is: ABA-inducible BHLH-type transcription factor
                     /product="basic helix-loop-helix (bHLH) DNA-binding
                     superfamily protein"
     gene            complement(111890..111961)
     tRNA            complement(111890..111961)
                     /note="pre-tRNA-tRNA-Gln (anticodon: CTG)"
     gene            112263..113947
                     /gene_synonym="''cytochrome P450"
                     /gene_synonym="cytochrome P450"
                     /gene_synonym="family 703"
                     /gene_synonym="polypeptide 2"
                     /gene_synonym="polypeptide 2''"
                     /gene_synonym="subfamily A"
                     /note="member of CYP703A CYP703A2 is expressed
                     specifically in anthers of land plants, catalyzing the
                     in-chain hydroxylation at the C-7 position of medium-chain
                     saturated fatty acids (lauric acid in-chain hydroxylase)
                     which is involved in pollen development (sporopollenin
     mRNA            join(112263..113195,113279..113947)
                     /gene_synonym="''cytochrome P450"
                     /gene_synonym="cytochrome P450"
                     /gene_synonym="family 703"
                     /gene_synonym="polypeptide 2"
                     /gene_synonym="polypeptide 2''"
                     /gene_synonym="subfamily A"
                     /product="cytochrome P450, family 703, subfamily A,
                     polypeptide 2"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             join(112290..113195,113279..113905)
                     /gene_synonym="''cytochrome P450"
                     /gene_synonym="cytochrome P450"
                     /gene_synonym="family 703"
                     /gene_synonym="polypeptide 2"
                     /gene_synonym="polypeptide 2''"
                     /gene_synonym="subfamily A"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="''cytochrome P450, family 703, subfamily A,
                     polypeptide 2'' (CYP703A2); FUNCTIONS IN: oxidoreductase
                     activity, acting on paired donors, with incorporation or
                     reduction of molecular oxygen, NADH or NADPH as one donor,
                     and incorporation of one atom of oxygen, oxygen binding;
                     INVOLVED IN: medium-chain fatty acid metabolic process,
                     pollen wall assembly, medium-chain fatty acid biosynthetic
                     process, sporopollenin biosynthetic process, pollen exine
                     formation; LOCATED IN: endomembrane system; EXPRESSED IN:
                     6 plant structures; EXPRESSED DURING: petal
                     differentiation and expansion stage; CONTAINS InterPro
                     DOMAIN/s: Cytochrome P450 (InterPro:IPR001128), Cytochrome
                     P450, conserved site (InterPro:IPR017972), Cytochrome
                     P450, E-class, group I (InterPro:IPR002401); BEST
                     Arabidopsis thaliana protein match is: Cytochrome P450
                     superfamily protein (TAIR:AT5G07990.1); Has 29652 Blast
                     hits to 29399 proteins in 1569 species: Archae - 44;
                     Bacteria - 2451; Metazoa - 11172; Fungi - 6019; Plants -
                     9091; Viruses - 3; Other Eukaryotes - 872 (source: NCBI
                     /product="cytochrome P450, family 703, subfamily A,
                     polypeptide 2"
     gene            114202..116407
                     /gene_synonym="cofactor of nitrate reductase and xanthine
                     dehydrogenase 3"
                     DEHYDROGENASE 3. Encodes a protein involved in molybdenum
                     cofactor biosynthesis. Homologous to E.coli MoaC.
                     Expression is low in all tissues examined, except in
                     roots. Appears to have targeting signals for chloroplast
                     or mitochondria"
     mRNA            join(114202..114433,114619..116407)
                     /gene_synonym="cofactor of nitrate reductase and xanthine
                     dehydrogenase 3"
                     /product="cofactor of nitrate reductase and xanthine
                     dehydrogenase 3"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:BT025641.1"
     mRNA            join(114202..114433,114619..115339,115961..116407)
                     /gene_synonym="cofactor of nitrate reductase and xanthine
                     dehydrogenase 3"
                     /product="cofactor of nitrate reductase and xanthine
                     dehydrogenase 3"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             join(114299..114433,114619..115296)
                     /gene_synonym="cofactor of nitrate reductase and xanthine
                     dehydrogenase 3"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="cofactor of nitrate reductase and xanthine
                     dehydrogenase 3 (CNX3); CONTAINS InterPro DOMAIN/s:
                     Molybdopterin cofactor biosynthesis C (MoaC) domain
                     (InterPro:IPR002820); Has 5242 Blast hits to 5240 proteins
                     in 1916 species: Archae - 213; Bacteria - 3669; Metazoa -
                     104; Fungi - 75; Plants - 45; Viruses - 0; Other
                     Eukaryotes - 1136 (source: NCBI BLink)."
                     /product="cofactor of nitrate reductase and xanthine
                     dehydrogenase 3"
     CDS             join(114299..114433,114619..115296)
                     /gene_synonym="cofactor of nitrate reductase and xanthine
                     dehydrogenase 3"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:BT025641.1"
                     /note="cofactor of nitrate reductase and xanthine
                     dehydrogenase 3 (CNX3); CONTAINS InterPro DOMAIN/s:
                     Molybdopterin cofactor biosynthesis C (MoaC) domain
                     (InterPro:IPR002820); Has 5242 Blast hits to 5240 proteins
                     in 1916 species: Archae - 213; Bacteria - 3669; Metazoa -
                     104; Fungi - 75; Plants - 45; Viruses - 0; Other
                     Eukaryotes - 1136 (source: NCBI BLink)."
                     /product="cofactor of nitrate reductase and xanthine
                     dehydrogenase 3"
     gene            116784..118845
     mRNA            116784..118845
                     /product="Eukaryotic aspartyl protease family protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             117065..118522
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="Eukaryotic aspartyl protease family protein;
                     FUNCTIONS IN: aspartic-type endopeptidase activity;
                     INVOLVED IN: proteolysis, response to karrikin; LOCATED
                     IN: membrane, plant-type cell wall; EXPRESSED IN: 22 plant
                     structures; EXPRESSED DURING: 13 growth stages; CONTAINS
                     InterPro DOMAIN/s: Peptidase aspartic
                     (InterPro:IPR021109), Peptidase aspartic, catalytic
                     (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461);
                     BEST Arabidopsis thaliana protein match is: Eukaryotic
                     aspartyl protease family protein (TAIR:AT3G61820.1); Has
                     3898 Blast hits to 3871 proteins in 332 species: Archae -
                     0; Bacteria - 0; Metazoa - 1165; Fungi - 579; Plants -
                     1953; Viruses - 0; Other Eukaryotes - 201 (source: NCBI
                     /product="Eukaryotic aspartyl protease family protein"
     gene            119381..119997
     mRNA            119381..119997
                     /product="hypothetical protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:EF183180.1"
     CDS             119429..119854
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:EF183180.1"
                     /note="unknown protein; FUNCTIONS IN: molecular_function
                     unknown; INVOLVED IN: biological_process unknown; LOCATED
                     IN: endomembrane system; Has 30201 Blast hits to 17322
                     proteins in 780 species: Archae - 12; Bacteria - 1396;
                     Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0;
                     Other Eukaryotes - 2996 (source: NCBI BLink)."
                     /product="hypothetical protein"
     gene            120154..121130
     mRNA            120154..121130
                     /product="CAP (Cysteine-rich secretory proteins, Antigen
                     5, and Pathogenesis-related 1 protein) superfamily
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             120221..120946
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="CAP (Cysteine-rich secretory proteins, Antigen 5,
                     and Pathogenesis-related 1 protein) superfamily protein;
                     FUNCTIONS IN: molecular_function unknown; INVOLVED IN:
                     biological_process unknown; LOCATED IN: extracellular
                     region; EXPRESSED IN: 6 plant structures; EXPRESSED
                     DURING: L mature pollen stage, M germinated pollen stage,
                     4 anthesis, petal differentiation and expansion stage;
                     CONTAINS InterPro DOMAIN/s: Allergen V5/Tpx-1 related,
                     conserved site (InterPro:IPR018244), Allergen V5/Tpx-1
                     related (InterPro:IPR001283), Ves allergen
                     (InterPro:IPR002413), SCP-like extracellular
                     (InterPro:IPR014044); BEST Arabidopsis thaliana protein
                     match is: CAP (Cysteine-rich secretory proteins, Antigen
                     5, and Pathogenesis-related 1 protein) superfamily protein
                     (TAIR:AT3G09590.1); Has 2987 Blast hits to 2892 proteins
                     in 368 species: Archae - 0; Bacteria - 64; Metazoa - 1591;
                     Fungi - 333; Plants - 892; Viruses - 0; Other Eukaryotes -
                     107 (source: NCBI BLink)."
                     /product="CAP (Cysteine-rich secretory proteins, Antigen
                     5, and Pathogenesis-related 1 protein) superfamily
     gene            complement(121067..130577)
     mRNA            complement(join(121067..121406,121493..123495,
                     /product="Tetratricopeptide repeat (TPR)-like superfamily
     mRNA            complement(join(121067..121406,121493..123501,
                     /product="Tetratricopeptide repeat (TPR)-like superfamily
     mRNA            complement(join(121124..121406,121493..123501,
                     /product="Tetratricopeptide repeat (TPR)-like superfamily
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             complement(join(121582..123495,123579..123669,
                     /note="Tetratricopeptide repeat (TPR)-like superfamily
                     protein; FUNCTIONS IN: binding; LOCATED IN:
                     cellular_component unknown; EXPRESSED IN: 24 plant
                     structures; EXPRESSED DURING: 14 growth stages; CONTAINS
                     InterPro DOMAIN/s: Tetratricopeptide-like helical
                     (InterPro:IPR011990), Tetratricopeptide repeat-containing
                     (InterPro:IPR013026), Tetratricopeptide repeat
                     (InterPro:IPR019734); BEST Arabidopsis thaliana protein
                     match is: Tetratricopeptide repeat (TPR)-like superfamily
                     protein (TAIR:AT4G28080.1)."
                     /product="Tetratricopeptide repeat (TPR)-like superfamily
     CDS             complement(join(121582..123501,123579..123669,
                     /product="Tetratricopeptide repeat (TPR)-like superfamily
     CDS             complement(join(121582..123501,123579..123669,
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="Tetratricopeptide repeat (TPR)-like superfamily
                     protein; FUNCTIONS IN: binding; LOCATED IN:
                     cellular_component unknown; EXPRESSED IN: 24 plant
                     structures; EXPRESSED DURING: 14 growth stages; CONTAINS
                     InterPro DOMAIN/s: Tetratricopeptide-like helical
                     (InterPro:IPR011990), Tetratricopeptide repeat-containing
                     (InterPro:IPR013026), Tetratricopeptide repeat
                     (InterPro:IPR019734); BEST Arabidopsis thaliana protein
                     match is: Tetratricopeptide repeat (TPR)-like superfamily
                     protein (TAIR:AT4G28080.1); Has 12123 Blast hits to 4846
                     proteins in 494 species: Archae - 106; Bacteria - 3214;
                     Metazoa - 4973; Fungi - 1823; Plants - 555; Viruses - 79;
                     Other Eukaryotes - 1373 (source: NCBI BLink)."
                     /product="Tetratricopeptide repeat (TPR)-like superfamily
     gene            130736..130858
     mRNA            130736..130858
                     /product="auxin-responsive endogenous peptide protein"
     CDS             130736..130858
                     /product="auxin-responsive endogenous peptide protein"
     gene            complement(132270..135924)
                     /gene_synonym="cyclic nucleotide gated channel 10"
                     /note="member of Cyclic nucleotide gated channel family"
     mRNA            complement(join(132270..132744,132824..133218,
                     /gene_synonym="cyclic nucleotide gated channel 10"
                     /product="cyclic nucleotide gated channel 10"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AF272002.3"
     mRNA            complement(join(132328..132744,132824..133218,
                     /gene_synonym="cyclic nucleotide gated channel 10"
                     /product="cyclic nucleotide gated channel 10"
     CDS             complement(join(132414..132744,132824..133218,
                     /gene_synonym="cyclic nucleotide gated channel 10"
                     /note="cyclic nucleotide gated channel 10 (CNGC10);
                     FUNCTIONS IN: ion channel activity, cyclic nucleotide
                     binding, calmodulin binding; INVOLVED IN: ion transport,
                     transmembrane transport; LOCATED IN: membrane; EXPRESSED
                     IN: 14 plant structures; EXPRESSED DURING: 10 growth
                     stages; CONTAINS InterPro DOMAIN/s: Cyclic
                     nucleotide-binding (InterPro:IPR000595), Cyclic
                     nucleotide-binding-like (InterPro:IPR018490), Ion
                     transport (InterPro:IPR005821), RmlC-like jelly roll fold
                     (InterPro:IPR014710), IQ calmodulin-binding region
                     (InterPro:IPR000048); BEST Arabidopsis thaliana protein
                     match is: cyclic nucleotide-gated channel 13
                     /product="cyclic nucleotide gated channel 10"
     CDS             complement(join(132414..132744,132824..133218,
                     /gene_synonym="cyclic nucleotide gated channel 10"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AF272002.3"
                     /note="cyclic nucleotide gated channel 10 (CNGC10);
                     FUNCTIONS IN: ion channel activity, cyclic nucleotide
                     binding, calmodulin binding; INVOLVED IN: ion transport,
                     transmembrane transport; LOCATED IN: membrane; EXPRESSED
                     IN: 14 plant structures; EXPRESSED DURING: 10 growth
                     stages; CONTAINS InterPro DOMAIN/s: Cyclic
                     nucleotide-binding (InterPro:IPR000595), Ion transport
                     (InterPro:IPR005821), Cyclic nucleotide-binding-like
                     (InterPro:IPR018490), RmlC-like jelly roll fold
                     (InterPro:IPR014710), IQ calmodulin-binding region
                     (InterPro:IPR000048); BEST Arabidopsis thaliana protein
                     match is: cyclic nucleotide-gated channel 13
                     (TAIR:AT4G01010.1); Has 3364 Blast hits to 3209 proteins
                     in 253 species: Archae - 0; Bacteria - 35; Metazoa - 1554;
                     Fungi - 48; Plants - 1027; Viruses - 0; Other Eukaryotes -
                     700 (source: NCBI BLink)."
                     /product="cyclic nucleotide gated channel 10"
     gene            136090..138162
     mRNA            join(136090..136234,136667..136816,136935..137758,
                     /product="Zinc finger (CCCH-type/C3HC4-type RING finger)
                     family protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             join(136732..136816,136935..137758,137848..137970)
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="Zinc finger (CCCH-type/C3HC4-type RING finger)
                     family protein; FUNCTIONS IN: zinc ion binding, nucleic
                     acid binding; CONTAINS InterPro DOMAIN/s: Zinc finger,
                     CCCH-type (InterPro:IPR000571), Zinc finger, RING-type,
                     conserved site (InterPro:IPR017907), Zinc finger,
                     RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana
                     protein match is: Zinc finger (CCCH-type/C3HC4-type RING
                     finger) family protein (TAIR:AT5G06420.2); Has 30201 Blast
                     hits to 17322 proteins in 780 species: Archae - 12;
                     Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants -
                     5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI
                     /product="Zinc finger (CCCH-type/C3HC4-type RING finger)
                     family protein"
     gene            138489..139680
     mRNA            join(138489..138778,138875..138914,138989..139114,
                     /product="Putative endonuclease or glycosyl hydrolase"
     mRNA            join(138513..138541,138597..138778,138863..139114,
                     /product="Putative endonuclease or glycosyl hydrolase"
     mRNA            join(138513..138541,138597..138778,138875..139114,
                     /product="Putative endonuclease or glycosyl hydrolase"
     CDS             join(138513..138541,138597..138778,138863..139114,
                     /note="Putative endonuclease or glycosyl hydrolase;
                     FUNCTIONS IN: zinc ion binding; INVOLVED IN:
                     biological_process unknown; LOCATED IN: intracellular;
                     CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-type
                     (InterPro:IPR007087); BEST Arabidopsis thaliana protein
                     match is: Putative endonuclease or glycosyl hydrolase
                     (TAIR:AT5G35640.1); Has 30201 Blast hits to 17322 proteins
                     in 780 species: Archae - 12; Bacteria - 1396; Metazoa -
                     17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other
                     Eukaryotes - 2996 (source: NCBI BLink)."
                     /product="Putative endonuclease or glycosyl hydrolase"
     CDS             join(138513..138541,138597..138778,138875..139114,
                     /product="Putative endonuclease or glycosyl hydrolase"
     CDS             join(138722..138778,138875..138914,138989..139114,
                     /product="Putative endonuclease or glycosyl hydrolase"
     gene            141870..143261
                     /gene_synonym="PYRABACTIN RESISTANCE 1-LIKE 9"
                     /gene_synonym="regulatory component of ABA receptor 1"
                     /note="Encodes RCAR1 (regulatory components of ABA
                     receptor). Interacts with and regulates the type 2C
                     protein phosphatases (PP2Cs) ABI1 and ABI2. Functions as
                     abscisic acid sensor."
     mRNA            join(141870..142281,142424..142639,142711..143261)
                     /gene_synonym="PYRABACTIN RESISTANCE 1-LIKE 9"
                     /gene_synonym="regulatory component of ABA receptor 1"
                     /product="regulatory component of ABA receptor 1"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             join(142138..142281,142424..142639,142711..142914)
                     /gene_synonym="PYRABACTIN RESISTANCE 1-LIKE 9"
                     /gene_synonym="regulatory component of ABA receptor 1"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="regulatory component of ABA receptor 1 (RCAR1);
                     CONTAINS InterPro DOMAIN/s: Polyketide cyclase/dehydrase
                     (InterPro:IPR019587); BEST Arabidopsis thaliana protein
                     match is: PYR1-like 7 (TAIR:AT4G01026.1); Has 395 Blast
                     hits to 395 proteins in 28 species: Archae - 0; Bacteria -
                     3; Metazoa - 0; Fungi - 0; Plants - 392; Viruses - 0;
                     Other Eukaryotes - 0 (source: NCBI BLink)."
                     /product="regulatory component of ABA receptor 1"
     gene            143489..146479
                     /gene_synonym="CENTROMERIC HISTONE H3"
                     /note="Encodes a centromere-identifying protein histone H3
                     variant. Localized at centromeres in both mitotic and
                     meiotic cells."
     mRNA            join(143489..143676,143764..143824,143934..143977,
                     /gene_synonym="CENTROMERIC HISTONE H3"
                     /product="Histone superfamily protein"
     mRNA            join(143489..143824,143934..143977,144064..144109,
                     /gene_synonym="CENTROMERIC HISTONE H3"
                     /product="Histone superfamily protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     mRNA            join(143489..143676,143764..143824,143934..143977,
                     /gene_synonym="CENTROMERIC HISTONE H3"
                     /product="Histone superfamily protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     mRNA            join(143522..143676,143761..143824,143934..143977,
                     /gene_synonym="CENTROMERIC HISTONE H3"
                     /product="Histone superfamily protein"
     CDS             join(143773..143824,143934..143977,144064..144109,
                     /gene_synonym="CENTROMERIC HISTONE H3"
                     /product="Histone superfamily protein"
     CDS             join(143773..143824,143934..143977,144064..144109,
                     /gene_synonym="CENTROMERIC HISTONE H3"
                     /product="Histone superfamily protein"
     CDS             join(143773..143824,143934..143977,144064..144109,
                     /gene_synonym="CENTROMERIC HISTONE H3"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="HTR12; FUNCTIONS IN: DNA binding; INVOLVED IN:
                     double fertilization forming a zygote and endosperm;
                     LOCATED IN: chromosome, centromeric region, nucleus;
                     EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8
                     growth stages; CONTAINS InterPro DOMAIN/s: Histone H3
                     (InterPro:IPR000164), Histone-fold (InterPro:IPR009072),
                     Histone core (InterPro:IPR007125); BEST Arabidopsis
                     thaliana protein match is: male-gamete-specific histone H3
                     (TAIR:AT1G19890.1); Has 14361 Blast hits to 14354 proteins
                     in 7190 species: Archae - 0; Bacteria - 0; Metazoa -
                     10494; Fungi - 2020; Plants - 1256; Viruses - 0; Other
                     Eukaryotes - 591 (source: NCBI BLink)."
                     /product="Histone superfamily protein"
     CDS             join(143773..143824,143934..143977,144064..144109,
                     /gene_synonym="CENTROMERIC HISTONE H3"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="HTR12; FUNCTIONS IN: DNA binding; INVOLVED IN:
                     double fertilization forming a zygote and endosperm;
                     LOCATED IN: chromosome, centromeric region, nucleus;
                     EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8
                     growth stages; CONTAINS InterPro DOMAIN/s: Histone H3
                     (InterPro:IPR000164), Histone-fold (InterPro:IPR009072),
                     Histone core (InterPro:IPR007125); BEST Arabidopsis
                     thaliana protein match is: male-gamete-specific histone H3
                     (TAIR:AT1G19890.1); Has 35333 Blast hits to 34131 proteins
                     in 2444 species: Archae - 798; Bacteria - 22429; Metazoa -
                     974; Fungi - 991; Plants - 531; Viruses - 0; Other
                     Eukaryotes - 9610 (source: NCBI BLink)."
                     /product="Histone superfamily protein"
     gene            147043..148014
                     /gene_synonym="ENHANCER OF TRY AND CPC 1"
                     /note="ETC1 is involved in trichome and root hair
                     patterning in Arabidopsis."
     mRNA            join(147043..147333,147452..148014)
                     /gene_synonym="ENHANCER OF TRY AND CPC 1"
                     /product="Homeodomain-like superfamily protein"
     mRNA            join(147043..147333,147452..147539,147644..148014)
                     /gene_synonym="ENHANCER OF TRY AND CPC 1"
                     /product="Homeodomain-like superfamily protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AY519518.1"
     mRNA            join(147153..147333,147452..147528,147644..147942)
                     /gene_synonym="ENHANCER OF TRY AND CPC 1"
                     /product="Homeodomain-like superfamily protein"
     CDS             join(147267..147333,147452..147539,147644..147740)
                     /gene_synonym="ENHANCER OF TRY AND CPC 1"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AY519518.1"
                     /note="ENHANCER OF TRY AND CPC 1 (ETC1); FUNCTIONS IN: DNA
                     binding, sequence-specific DNA binding transcription
                     factor activity; INVOLVED IN: regulation of transcription,
                     DNA-dependent, regulation of transcription; EXPRESSED IN:
                     shoot apex, hypocotyl, root; CONTAINS InterPro DOMAIN/s:
                     SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like
                     (InterPro:IPR009057), Myb, DNA-binding
                     (InterPro:IPR014778), Homeodomain-related
                     (InterPro:IPR012287), Myb transcription factor
                     (InterPro:IPR015495); BEST Arabidopsis thaliana protein
                     match is: CAPRICE-like MYB3 (TAIR:AT4G01060.1); Has 2220
                     Blast hits to 2220 proteins in 165 species: Archae - 0;
                     Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2207;
                     Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink)."
                     /product="Homeodomain-like superfamily protein"
     CDS             join(147267..147333,147452..147528,147644..147694)
                     /gene_synonym="ENHANCER OF TRY AND CPC 1"
                     /product="Homeodomain-like superfamily protein"
     CDS             join(147267..147333,147452..147567)
                     /gene_synonym="ENHANCER OF TRY AND CPC 1"
                     /product="Homeodomain-like superfamily protein"
     gene            complement(148013..149848)
     mRNA            complement(148013..149848)
                     /product="UDP-Glycosyltransferase superfamily protein"
     mRNA            complement(148018..149806)
                     /product="UDP-Glycosyltransferase superfamily protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             complement(148319..149812)
                     /product="UDP-Glycosyltransferase superfamily protein"
     CDS             complement(148319..149761)
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="UDP-Glycosyltransferase superfamily protein;
                     FUNCTIONS IN: UDP-glycosyltransferase activity,
                     transferase activity, transferring glycosyl groups;
                     INVOLVED IN: metabolic process; EXPRESSED IN: 7 plant
                     structures; EXPRESSED DURING: 9 growth stages; CONTAINS
                     InterPro DOMAIN/s:
                     (InterPro:IPR002213); BEST Arabidopsis thaliana protein
                     match is: UDP-glucosyl transferase 72B3
                     (TAIR:AT1G01420.1); Has 7970 Blast hits to 7908 proteins
                     in 429 species: Archae - 0; Bacteria - 359; Metazoa -
                     2438; Fungi - 37; Plants - 5024; Viruses - 48; Other
                     Eukaryotes - 64 (source: NCBI BLink)."
                     /product="UDP-Glycosyltransferase superfamily protein"
     gene            complement(150689..152210)
     mRNA            complement(join(150689..151298,151393..151731,
                     /product="hypothetical protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AY735499.1"
     CDS             complement(join(151158..151298,151393..151731,
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AY735499.1"
                     /note="unknown protein; Has 21 Blast hits to 21 proteins
                     in 8 species: Archae - 0; Bacteria - 2; Metazoa - 2; Fungi
                     - 1; Plants - 13; Viruses - 0; Other Eukaryotes - 3
                     (source: NCBI BLink)."
                     /product="hypothetical protein"
     gene            153113..154198
                     /gene_synonym="pumilio 22"
                     /note="Encodes a member of the Arabidopsis Pumilio (APUM)
                     proteins containing PUF domain (eight repeats of
                     approximately 36 amino acids each). PUF proteins regulate
                     both mRNA stability and translation through
                     sequence-specific binding to the 3' UTR of target mRNA
     mRNA            153113..154198
                     /gene_synonym="pumilio 22"
                     /product="pumilio 22"
     CDS             153113..154198
                     /gene_synonym="pumilio 22"
                     /note="pumilio 22 (PUM22); FUNCTIONS IN: RNA binding,
                     binding; INVOLVED IN: biological_process unknown; LOCATED
                     IN: cellular_component unknown; CONTAINS InterPro
                     DOMAIN/s: Pumilio RNA-binding repeat (InterPro:IPR001313),
                     Armadillo-like helical (InterPro:IPR011989),
                     Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis
                     thaliana protein match is: ARM repeat superfamily protein
                     (TAIR:AT5G64490.1); Has 304 Blast hits to 271 proteins in
                     75 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi -
                     65; Plants - 186; Viruses - 0; Other Eukaryotes - 52
                     (source: NCBI BLink)."
                     /product="pumilio 22"
     gene            complement(154367..156178)
                     /gene_synonym="UDP-glucosyl transferase 72B3"
     mRNA            complement(154367..156178)
                     /gene_synonym="UDP-glucosyl transferase 72B3"
                     /product="UDP-glucosyl transferase 72B3"
     mRNA            complement(154492..156011)
                     /gene_synonym="UDP-glucosyl transferase 72B3"
                     /product="UDP-glucosyl transferase 72B3"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             complement(154566..156020)
                     /gene_synonym="UDP-glucosyl transferase 72B3"
                     /product="UDP-glucosyl transferase 72B3"
     CDS             complement(154566..156011)
                     /gene_synonym="UDP-glucosyl transferase 72B3"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="UDP-glucosyl transferase 72B3 (UGT72B3); FUNCTIONS
                     IN: quercetin 3-O-glucosyltransferase activity,
                     UDP-glycosyltransferase activity, transferase activity,
                     transferring glycosyl groups; INVOLVED IN: metabolic
                     process; LOCATED IN: cellular_component unknown; EXPRESSED
                     IN: 11 plant structures; EXPRESSED DURING: LP.04 four
                     leaves visible, petal differentiation and expansion stage;
                     CONTAINS InterPro DOMAIN/s:
                     (InterPro:IPR002213); BEST Arabidopsis thaliana protein
                     match is: UDP-Glycosyltransferase superfamily protein
                     (TAIR:AT1G01390.1); Has 7961 Blast hits to 7896 proteins
                     in 480 species: Archae - 0; Bacteria - 474; Metazoa -
                     2294; Fungi - 32; Plants - 5027; Viruses - 70; Other
                     Eukaryotes - 64 (source: NCBI BLink)."
                     /product="UDP-glucosyl transferase 72B3"
     gene            complement(156477..158823)
                     /gene_synonym="TRICHOME BIREFRINGENCE-LIKE 25"
                     /note="Encodes a member of the TBL (TRICHOME
                     BIREFRINGENCE-LIKE) gene family containing a
                     plant-specific DUF231 (domain of unknown function) domain.
                     TBL gene family has 46 members, two of which
                     (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be
                     involved in the synthesis and deposition of secondary wall
                     cellulose, presumably by influencing the esterification
                     state of pectic polymers. A nomenclature for this gene
                     family has been proposed (Volker Bischoff & Wolf Scheible,
                     2010, personal communication)."
     mRNA            complement(join(156477..157756,157829..158112,
                     /gene_synonym="TRICHOME BIREFRINGENCE-LIKE 25"
                     /product="TRICHOME BIREFRINGENCE-LIKE 25"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             complement(join(156953..157756,157829..158112,
                     /gene_synonym="TRICHOME BIREFRINGENCE-LIKE 25"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="TRICHOME BIREFRINGENCE-LIKE 25 (TBL25); CONTAINS
                     InterPro DOMAIN/s: Protein of unknown function DUF231,
                     plant (InterPro:IPR004253); BEST Arabidopsis thaliana
                     protein match is: TRICHOME BIREFRINGENCE-LIKE 26
                     (TAIR:AT4G01080.1); Has 1353 Blast hits to 1335 proteins
                     in 35 species: Archae - 0; Bacteria - 0; Metazoa - 0;
                     Fungi - 6; Plants - 1340; Viruses - 0; Other Eukaryotes -
                     7 (source: NCBI BLink)."
                     /product="TRICHOME BIREFRINGENCE-LIKE 25"
     gene            complement(159628..162953)
     mRNA            complement(join(159628..159992,160079..160302,
                     /product="hypothetical protein (DUF3133)"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:BT010599.1"
     CDS             complement(join(159935..159992,160079..160302,
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:BT010599.1"
                     /note="Protein of unknown function (DUF3133); CONTAINS
                     InterPro DOMAIN/s: Protein of unknown function DUF3133
                     (InterPro:IPR021480); BEST Arabidopsis thaliana protein
                     match is: Protein of unknown function (DUF3133)
                     (TAIR:AT4G01090.1); Has 702 Blast hits to 662 proteins in
                     107 species: Archae - 0; Bacteria - 15; Metazoa - 235;
                     Fungi - 59; Plants - 328; Viruses - 0; Other Eukaryotes -
                     65 (source: NCBI BLink)."
                     /product="hypothetical protein (DUF3133)"
     gene            163278..166353
                     /note="Natural antisense transcript overlaps with
                     Potential natural antisense gene, locus overlaps with
     ncRNA           join(163278..163516,163934..164103,164225..164686,
                     /product="other RNA"
     ncRNA           join(163278..163516,163934..164103,164225..164686,
                     /product="other RNA"
     ncRNA           join(163302..163516,163934..164103,164225..164686,
                     /product="other RNA"
     gene            complement(164105..165517)
     mRNA            complement(164105..165517)
                     /product="Protein kinase superfamily protein"
                     /inference="Similar to RNA sequence,
     CDS             complement(164105..165517)
                     /inference="Similar to RNA sequence,
                     /note="Protein kinase superfamily protein; FUNCTIONS IN:
                     protein serine/threonine/tyrosine kinase activity, kinase
                     activity; INVOLVED IN: protein amino acid phosphorylation;
                     LOCATED IN: cellular_component unknown; EXPRESSED IN:
                     pollen tube; CONTAINS InterPro DOMAIN/s: Protein kinase,
                     catalytic domain (InterPro:IPR000719),
                     Serine/threonine-protein kinase domain
                     (InterPro:IPR002290), Tyrosine-protein kinase, catalytic
                     domain (InterPro:IPR020635),
                     Serine-threonine/tyrosine-protein kinase
                     (InterPro:IPR001245), Protein kinase-like domain
                     (InterPro:IPR011009); BEST Arabidopsis thaliana protein
                     match is: Protein kinase family protein
                     (TAIR:AT1G64300.2); Has 73829 Blast hits to 73194 proteins
                     in 2427 species: Archae - 72; Bacteria - 7086; Metazoa -
                     29204; Fungi - 5761; Plants - 19826; Viruses - 200; Other
                     Eukaryotes - 11680 (source: NCBI BLink)."
                     /product="Protein kinase superfamily protein"
     gene            complement(166589..168088)
     mRNA            complement(join(166589..166871,167014..168088))
                     /product="late embryogenesis abundant hydroxyproline-rich
                     glycoprotein family protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:EF183207.1"
     mRNA            complement(166618..167842)
                     /product="late embryogenesis abundant hydroxyproline-rich
                     glycoprotein family protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:EF183208.1"
     CDS             complement(join(166853..166871,167014..167798))
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:EF183207.1"
                     /note="unknown protein; FUNCTIONS IN: molecular_function
                     unknown; INVOLVED IN: biological_process unknown; LOCATED
                     IN: cellular_component unknown; BEST Arabidopsis thaliana
                     protein match is: unknown protein (TAIR:AT4G01110.1); Has
                     30201 Blast hits to 17322 proteins in 780 species: Archae
                     - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422;
                     Plants - 5037; Viruses - 0; Other Eukaryotes - 2996
                     (source: NCBI BLink)."
                     /product="late embryogenesis abundant hydroxyproline-rich
                     glycoprotein family protein"
     CDS             complement(166929..167798)
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:EF183208.1"
                     /note="unknown protein; FUNCTIONS IN: molecular_function
                     unknown; INVOLVED IN: biological_process unknown; LOCATED
                     IN: cellular_component unknown; BEST Arabidopsis thaliana
                     protein match is: unknown protein (TAIR:AT4G01110.1); Has
                     30201 Blast hits to 17322 proteins in 780 species: Archae
                     - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422;
                     Plants - 5037; Viruses - 0; Other Eukaryotes - 2996
                     (source: NCBI BLink)."
                     /product="late embryogenesis abundant hydroxyproline-rich
                     glycoprotein family protein"
     gene            168559..171386
                     /note="Type I phosphatidylinositol-4-phosphate 5-kinase,
                     subfamily A."
     mRNA            join(168559..168801,169037..169257,169347..169509,
                     /product="Phosphatidylinositol-4-phosphate 5-kinase, core"
                     /inference="similar to RNA sequence,
     CDS             join(169115..169257,169347..169509,169600..169710,
                     /inference="similar to RNA sequence,
                     /note="PIPK11; FUNCTIONS IN:
                     1-phosphatidylinositol-4-phosphate 5-kinase activity,
                     phosphatidylinositol phosphate kinase activity; INVOLVED
                     IN: phosphatidylinositol metabolic process; LOCATED IN:
                     cellular_component unknown; EXPRESSED IN: sperm cell,
                     sepal, male gametophyte, flower, pollen tube; EXPRESSED
                     DURING: L mature pollen stage, M germinated pollen stage,
                     4 anthesis; CONTAINS InterPro DOMAIN/s:
                     Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup
                     (InterPro:IPR016034), Phosphatidylinositol-4-phosphate
                     5-kinase, core (InterPro:IPR002498); BEST Arabidopsis
                     thaliana protein match is: phosphatidylinositol phosphate
                     kinase 10 (TAIR:AT4G01190.1); Has 2109 Blast hits to 1621
                     proteins in 223 species: Archae - 0; Bacteria - 2; Metazoa
                     - 980; Fungi - 317; Plants - 416; Viruses - 0; Other
                     Eukaryotes - 394 (source: NCBI BLink)."
                     /product="Phosphatidylinositol-4-phosphate 5-kinase, core"
     gene            complement(171525..172948)
                     /gene_synonym="LATE EMBRYOGENESIS ABUNDANT 14"
                     /gene_synonym="LIGHT STRESS-REGULATED 3"
                     /note="Encodes late-embryogenesis abundant protein whose
                     mRNA levels are induced in response to wounding and light
                     stress. Might be involved in protection against
     mRNA            complement(join(171525..172544,172621..172948))
                     /gene_synonym="LATE EMBRYOGENESIS ABUNDANT 14"
                     /gene_synonym="LIGHT STRESS-REGULATED 3"
                     /product="Late embryogenesis abundant protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             complement(join(172295..172544,172621..172826))
                     /gene_synonym="LATE EMBRYOGENESIS ABUNDANT 14"
                     /gene_synonym="LIGHT STRESS-REGULATED 3"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="LATE EMBRYOGENESIS ABUNDANT 14 (LEA14); CONTAINS
                     InterPro DOMAIN/s: Water stress and hypersensitive
                     response domain (InterPro:IPR013990), Late embryogenesis
                     abundant protein, group 2 (InterPro:IPR004864); BEST
                     Arabidopsis thaliana protein match is: Late embryogenesis
                     abundant protein (TAIR:AT2G46140.1); Has 340 Blast hits to
                     340 proteins in 93 species: Archae - 0; Bacteria - 10;
                     Metazoa - 0; Fungi - 0; Plants - 329; Viruses - 0; Other
                     Eukaryotes - 1 (source: NCBI BLink)."
                     /product="Late embryogenesis abundant protein"
     gene            175706..178406
                     /gene_synonym="1-amino-cyclopropane-1-carboxylate synthase
                     /gene_synonym="1-AMINOCYCLOPROPANE-1-CARBOXYLATE SYNTHASE"
                     /note="a member of the 1-aminocyclopropane-1-carboxylate
                     (ACC) synthase (S-adenosyl-L-methionine
                     methylthioadenosine-lyase, EC gene family,
                     isolated from a flower-specific cDNA library."
     mRNA            join(175706..176032,176207..176338,176592..176752,
                     /gene_synonym="1-amino-cyclopropane-1-carboxylate synthase
                     /gene_synonym="1-AMINOCYCLOPROPANE-1-CARBOXYLATE SYNTHASE"
                     /product="1-amino-cyclopropane-1-carboxylate synthase 2"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             join(175862..176032,176207..176338,176592..176752,
                     /gene_synonym="1-amino-cyclopropane-1-carboxylate synthase
                     /gene_synonym="1-AMINOCYCLOPROPANE-1-CARBOXYLATE SYNTHASE"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="1-amino-cyclopropane-1-carboxylate synthase 2
                     (ACS2); CONTAINS InterPro DOMAIN/s:
                     1-aminocyclopropane-1-carboxylate synthase
                     (InterPro:IPR001176), Aminotransferase, class I/classII
                     (InterPro:IPR004839), Pyridoxal phosphate-dependent
                     transferase, major domain (InterPro:IPR015424),
                     Aminotransferases, class-I, pyridoxal-phosphate-binding
                     site (InterPro:IPR004838), Pyridoxal phosphate-dependent
                     transferase, major region, subdomain 2
                     (InterPro:IPR015422), Pyridoxal phosphate-dependent
                     transferase, major region, subdomain 1
                     (InterPro:IPR015421); BEST Arabidopsis thaliana protein
                     match is: ACC synthase 1 (TAIR:AT3G61510.1); Has 30194
                     Blast hits to 30192 proteins in 2936 species: Archae -
                     881; Bacteria - 20730; Metazoa - 650; Fungi - 807; Plants
                     - 1338; Viruses - 0; Other Eukaryotes - 5788 (source: NCBI
                     /product="1-amino-cyclopropane-1-carboxylate synthase 2"
     mRNA            join(176141..176338,176592..176752,177025..178400)
                     /gene_synonym="1-amino-cyclopropane-1-carboxylate synthase
                     /gene_synonym="1-AMINOCYCLOPROPANE-1-CARBOXYLATE SYNTHASE"
                     /product="1-amino-cyclopropane-1-carboxylate synthase 2"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             join(176607..176752,177025..178051)
                     /gene_synonym="1-amino-cyclopropane-1-carboxylate synthase
                     /gene_synonym="1-AMINOCYCLOPROPANE-1-CARBOXYLATE SYNTHASE"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="1-amino-cyclopropane-1-carboxylate synthase 2
                     (ACS2); CONTAINS InterPro DOMAIN/s:
                     1-aminocyclopropane-1-carboxylate synthase
                     (InterPro:IPR001176), Pyridoxal phosphate-dependent
                     transferase, major domain (InterPro:IPR015424),
                     Aminotransferase, class I/classII (InterPro:IPR004839),
                     Aminotransferases, class-I, pyridoxal-phosphate-binding
                     site (InterPro:IPR004838), Pyridoxal phosphate-dependent
                     transferase, major region, subdomain 1
                     (InterPro:IPR015421), Pyridoxal phosphate-dependent
                     transferase, major region, subdomain 2
                     (InterPro:IPR015422); BEST Arabidopsis thaliana protein
                     match is: ACC synthase 1 (TAIR:AT3G61510.1); Has 28365
                     Blast hits to 28364 proteins in 2923 species: Archae -
                     821; Bacteria - 19365; Metazoa - 634; Fungi - 793; Plants
                     - 1286; Viruses - 0; Other Eukaryotes - 5466 (source: NCBI
                     /product="1-amino-cyclopropane-1-carboxylate synthase 2"
     gene            complement(180017..182749)
     mRNA            complement(join(180017..180852,181347..182135,
                     /product="Heavy metal transport/detoxification superfamily
     mRNA            complement(join(180018..180852,181347..181422,
                     /product="Heavy metal transport/detoxification superfamily
     mRNA            complement(join(180056..180852,181347..181422,
                     /product="Heavy metal transport/detoxification superfamily
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     mRNA            complement(join(180056..180852,181347..181422,
                     /product="Heavy metal transport/detoxification superfamily
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:BX815252.1"
     CDS             complement(join(180401..180852,181347..181422,
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="Heavy metal transport/detoxification superfamily
                     protein; FUNCTIONS IN: metal ion binding; INVOLVED IN:
                     metal ion transport; LOCATED IN: cellular_component
                     unknown; EXPRESSED IN: 22 plant structures; EXPRESSED
                     DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s:
                     Heavy metal transport/detoxification protein
                     (InterPro:IPR006121); BEST Arabidopsis thaliana protein
                     match is: Heavy metal transport/detoxification superfamily
                     protein (TAIR:AT1G63950.1); Has 7083 Blast hits to 3987
                     proteins in 399 species: Archae - 47; Bacteria - 875;
                     Metazoa - 1731; Fungi - 337; Plants - 1157; Viruses - 96;
                     Other Eukaryotes - 2840 (source: NCBI BLink)."
                     /product="Heavy metal transport/detoxification superfamily
     CDS             complement(join(180401..180852,181347..181422,
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:BX815252.1"
                     /note="Heavy metal transport/detoxification superfamily
                     protein; FUNCTIONS IN: metal ion binding; INVOLVED IN:
                     metal ion transport; LOCATED IN: cellular_component
                     unknown; EXPRESSED IN: 22 plant structures; EXPRESSED
                     DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s:
                     Heavy metal transport/detoxification protein
                     (InterPro:IPR006121); BEST Arabidopsis thaliana protein
                     match is: Heavy metal transport/detoxification superfamily
                     protein (TAIR:AT1G63950.1); Has 35333 Blast hits to 34131
                     proteins in 2444 species: Archae - 798; Bacteria - 22429;
                     Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0;
                     Other Eukaryotes - 9610 (source: NCBI BLink)."
                     /product="Heavy metal transport/detoxification superfamily
     CDS             complement(join(180401..180852,181347..181422,
                     /product="Heavy metal transport/detoxification superfamily
     CDS             complement(180401..180835)
                     /product="Heavy metal transport/detoxification superfamily
     gene            185033..187135
     mRNA            join(185033..186009,186340..187135)
                     /product="Erythronate-4-phosphate dehydrogenase family
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             join(185260..186009,186340..186573)
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="Erythronate-4-phosphate dehydrogenase family
                     protein; BEST Arabidopsis thaliana protein match is:
                     Erythronate-4-phosphate dehydrogenase family protein
                     (TAIR:AT1G19400.2); Has 143 Blast hits to 143 proteins in
                     19 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi -
                     0; Plants - 143; Viruses - 0; Other Eukaryotes - 0
                     (source: NCBI BLink)."
                     /product="Erythronate-4-phosphate dehydrogenase family
     gene            187145..190472
                     /note="Encodes a homolog of human CtBP. Mutant has longer
                     and thicker leaves than wild type. Involved in controlling
                     polar cell expansion in the leaf width direction."
     mRNA            join(187145..187822,188011..188176,188284..188414,
                     /product="NAD(P)-binding Rossmann-fold superfamily
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             join(187235..187822,188011..188176,188284..188414,
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="ANGUSTIFOLIA (AN); CONTAINS InterPro DOMAIN/s:
                     D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding
                     (InterPro:IPR006140), NAD(P)-binding domain
                     (InterPro:IPR016040); BEST Arabidopsis thaliana protein
                     match is: D-isomer specific 2-hydroxyacid dehydrogenase
                     family protein (TAIR:AT1G12550.1); Has 20556 Blast hits to
                     20427 proteins in 2617 species: Archae - 372; Bacteria -
                     13694; Metazoa - 624; Fungi - 929; Plants - 529; Viruses -
                     5; Other Eukaryotes - 4403 (source: NCBI BLink)."
                     /product="NAD(P)-binding Rossmann-fold superfamily
     gene            190408..192436
                     /gene_synonym="ALTERED SEED GERMINATION 4"
     mRNA            join(190408..190828,190941..190998,191138..191258,
                     /gene_synonym="ALTERED SEED GERMINATION 4"
                     /product="Homeodomain-like superfamily protein"
     mRNA            join(190408..190828,190941..190998,191138..191258,
                     /gene_synonym="ALTERED SEED GERMINATION 4"
                     /product="Homeodomain-like superfamily protein"
     mRNA            join(190408..190828,190941..190998,191138..191258,
                     /gene_synonym="ALTERED SEED GERMINATION 4"
                     /product="Homeodomain-like superfamily protein"
     mRNA            join(190408..190828,190941..190998,191138..191258,
                     /gene_synonym="ALTERED SEED GERMINATION 4"
                     /product="Homeodomain-like superfamily protein"
                     /inference="Similar to RNA sequence, EST:INSD:DN604655.1"
                     /inference="similar to RNA sequence,
     mRNA            join(190478..190828,190941..190998,191138..191475,
                     /gene_synonym="ALTERED SEED GERMINATION 4"
                     /product="Homeodomain-like superfamily protein"
     CDS             join(190596..190828,190941..190998,191138..191258,
                     /gene_synonym="ALTERED SEED GERMINATION 4"
                     /inference="Similar to RNA sequence, EST:INSD:DN604655.1"
                     /inference="similar to RNA sequence,
                     /note="Homeodomain-like superfamily protein; CONTAINS
                     InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005),
                     Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding
                     (InterPro:IPR014778), Myb-like DNA-binding domain, SHAQKYF
                     class (InterPro:IPR006447), HTH transcriptional regulator,
                     Myb-type, DNA-binding (InterPro:IPR017930); BEST
                     Arabidopsis thaliana protein match is: Homeodomain-like
                     superfamily protein (TAIR:AT4G01280.1); Has 1311 Blast
                     hits to 1300 proteins in 113 species: Archae - 0; Bacteria
                     - 0; Metazoa - 59; Fungi - 0; Plants - 1067; Viruses - 0;
                     Other Eukaryotes - 185 (source: NCBI BLink)."
                     /product="Homeodomain-like superfamily protein"
     CDS             join(190596..190828,190941..190998,191138..191258,
                     /gene_synonym="ALTERED SEED GERMINATION 4"
                     /product="Homeodomain-like superfamily protein"
     CDS             join(190596..190828,190941..190998,191138..191258,
                     /gene_synonym="ALTERED SEED GERMINATION 4"
                     /product="Homeodomain-like superfamily protein"
     CDS             join(190596..190828,190941..190998,191138..191258,
                     /gene_synonym="ALTERED SEED GERMINATION 4"
                     /product="Homeodomain-like superfamily protein"
     CDS             join(191181..191475,191579..191692,191780..191889,
                     /gene_synonym="ALTERED SEED GERMINATION 4"
                     /product="Homeodomain-like superfamily protein"
     gene            complement(192634..193670)
                     /gene_synonym="AGAMOUS-like 28"
     mRNA            complement(join(192634..193071,193351..193670))
                     /gene_synonym="AGAMOUS-like 28"
                     /product="AGAMOUS-like 28"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             complement(join(192640..193071,193351..193662))
                     /gene_synonym="AGAMOUS-like 28"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="AGAMOUS-like 28 (AGL28); FUNCTIONS IN: DNA binding,
                     sequence-specific DNA binding transcription factor
                     activity; INVOLVED IN: regulation of transcription,
                     DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: central
                     cell, embryo, endosperm; CONTAINS InterPro DOMAIN/s:
                     Transcription factor, MADS-box (InterPro:IPR002100); BEST
                     Arabidopsis thaliana protein match is: AGAMOUS-like 23
                     (TAIR:AT1G65360.1); Has 6009 Blast hits to 6009 proteins
                     in 738 species: Archae - 0; Bacteria - 0; Metazoa - 628;
                     Fungi - 306; Plants - 4996; Viruses - 0; Other Eukaryotes
                     - 79 (source: NCBI BLink)."
                     /product="AGAMOUS-like 28"
     gene            195645..198787
     mRNA            join(195645..196542,197115..197219,197300..197422,
                     /product="Protein kinase superfamily protein"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     mRNA            join(195812..196542,197115..197219,197300..197422,
                     /product="Protein kinase superfamily protein"
                     /inference="Similar to RNA sequence,
     CDS             join(195980..196542,197115..197219,197300..197422,
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="Protein kinase superfamily protein; FUNCTIONS IN:
                     protein serine/threonine kinase activity, protein kinase
                     activity, kinase activity, ATP binding; INVOLVED IN:
                     protein amino acid phosphorylation; LOCATED IN: plasma
                     membrane; EXPRESSED IN: 23 plant structures; EXPRESSED
                     DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s:
                     Protein kinase, ATP binding site (InterPro:IPR017441),
                     Serine/threonine-protein kinase domain
                     (InterPro:IPR002290), Serine/threonine-protein kinase-like
                     domain (InterPro:IPR017442), Protein kinase-like domain
                     (InterPro:IPR011009), Serine/threonine-protein kinase,
                     active site (InterPro:IPR008271), Protein kinase,
                     catalytic domain (InterPro:IPR000719), Tyrosine-protein
                     kinase, catalytic domain (InterPro:IPR020635); BEST
                     Arabidopsis thaliana protein match is: Protein kinase
                     superfamily protein (TAIR:AT4G01330.1); Has 118949 Blast
                     hits to 117566 proteins in 4483 species: Archae - 118;
                     Bacteria - 14365; Metazoa - 43793; Fungi - 9783; Plants -
                     32976; Viruses - 455; Other Eukaryotes - 17459 (source:
                     NCBI BLink)."
                     /product="Protein kinase superfamily protein"
     CDS             join(195980..196542,197115..197219,197300..197422,
                     /inference="Similar to RNA sequence,
                     /note="Protein kinase superfamily protein; FUNCTIONS IN:
                     protein serine/threonine kinase activity, protein kinase
                     activity, kinase activity, ATP binding; INVOLVED IN:
                     protein amino acid phosphorylation; LOCATED IN: plasma
                     membrane; EXPRESSED IN: 23 plant structures; EXPRESSED
                     DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s:
                     Protein kinase, ATP binding site (InterPro:IPR017441),
                     Serine/threonine-protein kinase domain
                     (InterPro:IPR002290), Serine/threonine-protein kinase-like
                     domain (InterPro:IPR017442), Serine/threonine-protein
                     kinase, active site (InterPro:IPR008271), Protein
                     kinase-like domain (InterPro:IPR011009), Protein kinase,
                     catalytic domain (InterPro:IPR000719), Tyrosine-protein
                     kinase, catalytic domain (InterPro:IPR020635); BEST
                     Arabidopsis thaliana protein match is: Protein kinase
                     superfamily protein (TAIR:AT4G01330.2); Has 117942 Blast
                     hits to 116606 proteins in 4399 species: Archae - 110;
                     Bacteria - 14062; Metazoa - 43660; Fungi - 9737; Plants -
                     32599; Viruses - 442; Other Eukaryotes - 17332 (source:
                     NCBI BLink)."
                     /product="Protein kinase superfamily protein"
     gene            199527..201775
                     /gene_synonym="BYPASS 1"
                     /note="Encodes a protein with no functionally
                     characterized domains that to prevent the synthesis of a
                     novel substance that moves from the root to the shoot,
                     where it modifies shoot growth by interfering with auxin
                     signaling. Synthesis and delivery of this substance
                     requires neither phloem nor endodermis."
     mRNA            join(199527..199763,199890..199959,200511..201775)
                     /gene_synonym="BYPASS 1"
                     /product="BPS1-like protein (DUF793)"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     mRNA            join(199630..199959,200511..201775)
                     /gene_synonym="BYPASS 1"
                     /product="BPS1-like protein (DUF793)"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             200526..201575
                     /gene_synonym="BYPASS 1"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="BYPASS 1 (BPS1); FUNCTIONS IN: molecular_function
                     unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24
                     plant structures; EXPRESSED DURING: 13 growth stages;
                     CONTAINS InterPro DOMAIN/s: Protein BYPASS related
                     (InterPro:IPR008511); BEST Arabidopsis thaliana protein
                     match is: unknown protein (TAIR:AT2G46080.1); Has 170
                     Blast hits to 170 proteins in 24 species: Archae - 0;
                     Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 160;
                     Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink)."
                     /product="BPS1-like protein (DUF793)"
     CDS             200526..201575
                     /gene_synonym="BYPASS 1"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="BYPASS 1 (BPS1); FUNCTIONS IN: molecular_function
                     unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24
                     plant structures; EXPRESSED DURING: 13 growth stages;
                     CONTAINS InterPro DOMAIN/s: Protein BYPASS related
                     (InterPro:IPR008511); BEST Arabidopsis thaliana protein
                     match is: unknown protein (TAIR:AT2G46080.1); Has 35333
                     Blast hits to 34131 proteins in 2444 species: Archae -
                     798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants
                     - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI
                     /product="BPS1-like protein (DUF793)"
     gene            202103..204440
                     /gene_synonym="MAP kinase 11"
                     /note="member of MAP Kinase"
     mRNA            join(202103..202508,202782..202911,202991..203128,
                     /gene_synonym="MAP kinase 11"
                     /product="MAP kinase 11"
     mRNA            join(202111..202508,202782..202911,202991..203128,
                     /gene_synonym="MAP kinase 11"
                     /product="MAP kinase 11"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:BX815051.1"
     mRNA            join(202136..202508,202782..202911,202991..203128,
                     /gene_synonym="MAP kinase 11"
                     /product="MAP kinase 11"
                     /inference="Similar to RNA sequence,
     mRNA            join(202136..202508,202782..202911,202991..203128,
                     /gene_synonym="MAP kinase 11"
                     /product="MAP kinase 11"
     CDS             join(202345..202508,202782..202911,202991..203128,
                     /gene_synonym="MAP kinase 11"
                     /inference="Similar to RNA sequence,
                     /note="MAP kinase 11 (MPK11); FUNCTIONS IN: MAP kinase
                     activity, kinase activity; INVOLVED IN: signal
                     transduction, response to abscisic acid stimulus; LOCATED
                     IN: cellular_component unknown; EXPRESSED IN: 22 plant
                     structures; EXPRESSED DURING: 13 growth stages; CONTAINS
                     InterPro DOMAIN/s: Protein kinase, ATP binding site
                     (InterPro:IPR017441), Serine/threonine-protein kinase
                     domain (InterPro:IPR002290), JNK MAP kinase
                     (InterPro:IPR008351), Serine/threonine-protein kinase-like
                     domain (InterPro:IPR017442), Serine/threonine-protein
                     kinase, active site (InterPro:IPR008271), Protein
                     kinase-like domain (InterPro:IPR011009), MAP kinase,
                     conserved site (InterPro:IPR003527), Protein kinase,
                     catalytic domain (InterPro:IPR000719), Tyrosine-protein
                     kinase, catalytic domain (InterPro:IPR020635); BEST
                     Arabidopsis thaliana protein match is: MAP kinase 4
                     (TAIR:AT4G01370.1); Has 30201 Blast hits to 17322 proteins
                     in 780 species: Archae - 12; Bacteria - 1396; Metazoa -
                     17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other
                     Eukaryotes - 2996 (source: NCBI BLink)."
                     /product="MAP kinase 11"
     CDS             join(202345..202508,202782..202911,202991..203128,
                     /gene_synonym="MAP kinase 11"
                     /product="MAP kinase 11"
     CDS             join(202345..202508,202782..202911,202991..203128,
                     /gene_synonym="MAP kinase 11"
                     /product="MAP kinase 11"
     CDS             join(202345..202508,202782..202911,202991..203128,
                     /gene_synonym="MAP kinase 11"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:BX815051.1"
                     /note="MAP kinase 11 (MPK11); FUNCTIONS IN: MAP kinase
                     activity, kinase activity; INVOLVED IN: signal
                     transduction, response to abscisic acid stimulus; LOCATED
                     IN: cellular_component unknown; EXPRESSED IN: 22 plant
                     structures; EXPRESSED DURING: 13 growth stages; CONTAINS
                     InterPro DOMAIN/s: Protein kinase, ATP binding site
                     (InterPro:IPR017441), Serine/threonine-protein kinase
                     domain (InterPro:IPR002290), Serine/threonine-protein
                     kinase-like domain (InterPro:IPR017442),
                     Serine/threonine-protein kinase, active site
                     (InterPro:IPR008271), Protein kinase-like domain
                     (InterPro:IPR011009), MAP kinase, conserved site
                     (InterPro:IPR003527), Protein kinase, catalytic domain
                     (InterPro:IPR000719), Tyrosine-protein kinase, catalytic
                     domain (InterPro:IPR020635); BEST Arabidopsis thaliana
                     protein match is: MAP kinase 4 (TAIR:AT4G01370.1); Has
                     120594 Blast hits to 119420 proteins in 4621 species:
                     Archae - 98; Bacteria - 12299; Metazoa - 46324; Fungi -
                     12052; Plants - 29649; Viruses - 464; Other Eukaryotes -
                     19708 (source: NCBI BLink)."
                     /product="MAP kinase 11"
     gene            204935..207642
     mRNA            join(204935..205949,206692..207243,207325..207642)
                     /product="transferring glycosyl group transferase
     CDS             join(205083..205949,206692..207243,207325..207435)
                     /product="transferring glycosyl group transferase
     mRNA            join(205176..205949,206692..207243,207325..207435)
                     /product="transferring glycosyl group transferase
                     /inference="Similar to RNA sequence,
     CDS             join(205176..205949,206692..207243,207325..207435)
                     /inference="Similar to RNA sequence,
                     /note="FUNCTIONS IN: transferase activity, transferring
                     glycosyl groups; INVOLVED IN: biological_process unknown;
                     LOCATED IN: endomembrane system; EXPRESSED IN: 15 plant
                     structures; EXPRESSED DURING: 7 growth stages; CONTAINS
                     InterPro DOMAIN/s: Protein of unknown function DUF604
                     (InterPro:IPR006740); BEST Arabidopsis thaliana protein
                     match is: fringe-related protein (TAIR:AT4G00300.1); Has
                     558 Blast hits to 547 proteins in 95 species: Archae - 0;
                     Bacteria - 0; Metazoa - 99; Fungi - 169; Plants - 281;
                     Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink)."
                     /product="transferring glycosyl group transferase
     gene            208995..213082
                     /gene_synonym="FERRIC CHELATE REDUCTASE DEFECTIVE 1"
                     /gene_synonym="ferric reduction oxidase 2"
                     /gene_synonym="FERRIC REDUCTION OXIDASE 2"
                     /note="Encodes the low-iron-inducible ferric chelate
                     reductase responsible for reduction of iron at the root
                     surface. It is likely to be the major Fe(III) chelate
                     reductase in Arabidopsis iron metabolism. Coordinately
                     regulated with IRT1, the major transporter responsible for
                     high-affinity iron uptake from the soil, at both
                     transcriptional and posttranscriptional levels. Steady
                     state mRNA levels are regulated by several metals. Its
                     transcription is regulated by FIT1."
     mRNA            join(208995..209608,209764..209866,209950..210144,
                     /gene_synonym="FERRIC CHELATE REDUCTASE DEFECTIVE 1"
                     /gene_synonym="ferric reduction oxidase 2"
                     /gene_synonym="FERRIC REDUCTION OXIDASE 2"
                     /product="ferric reduction oxidase 2"
     CDS             join(209161..209608,209764..209866,209950..210144,
                     /gene_synonym="FERRIC CHELATE REDUCTASE DEFECTIVE 1"
                     /gene_synonym="ferric reduction oxidase 2"
                     /gene_synonym="FERRIC REDUCTION OXIDASE 2"
                     /product="ferric reduction oxidase 2"
     mRNA            join(209208..209608,209764..209866,209950..210144,
                     /gene_synonym="FERRIC CHELATE REDUCTASE DEFECTIVE 1"
                     /gene_synonym="ferric reduction oxidase 2"
                     /gene_synonym="FERRIC REDUCTION OXIDASE 2"
                     /product="ferric reduction oxidase 2"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AY302057.1"
     CDS             join(209395..209608,209764..209866,209950..210144,
                     /gene_synonym="FERRIC CHELATE REDUCTASE DEFECTIVE 1"
                     /gene_synonym="ferric reduction oxidase 2"
                     /gene_synonym="FERRIC REDUCTION OXIDASE 2"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AY302057.1"
                     /note="ferric reduction oxidase 2 (FRO2); CONTAINS
                     InterPro DOMAIN/s: Ferredoxin reductase-type FAD-binding
                     domain (InterPro:IPR017927), Ferric reductase, NAD binding
                     (InterPro:IPR013121), FAD-binding 8 (InterPro:IPR013112),
                     Riboflavin synthase-like beta-barrel (InterPro:IPR017938),
                     Ferric reductase-like transmembrane component, N-terminal
                     (InterPro:IPR013130); BEST Arabidopsis thaliana protein
                     match is: ferric reduction oxidase 1 (TAIR:AT1G01590.1);
                     Has 2711 Blast hits to 2707 proteins in 388 species:
                     Archae - 5; Bacteria - 307; Metazoa - 560; Fungi - 1180;
                     Plants - 483; Viruses - 0; Other Eukaryotes - 176 (source:
                     NCBI BLink)."
                     /product="ferric reduction oxidase 2"
     gene            214150..217734
                     /gene_synonym="ferric reduction oxidase 1"
                     /gene_synonym="FERRIC REDUCTION OXIDASE 1"
                     /note="Encodes a ferric-chelate reductase that is
                     expressed at extremely low levels in Fe deficiency-induced
     mRNA            join(214150..214406,214480..214582,214697..214897,
                     /gene_synonym="ferric reduction oxidase 1"
                     /gene_synonym="FERRIC REDUCTION OXIDASE 1"
                     /product="ferric reduction oxidase 1"
     CDS             join(214229..214406,214480..214582,214697..214897,
                     /gene_synonym="ferric reduction oxidase 1"
                     /gene_synonym="FERRIC REDUCTION OXIDASE 1"
                     /note="ferric reduction oxidase 1 (FRO1); FUNCTIONS IN:
                     ferric-chelate reductase activity; INVOLVED IN: oxidation
                     reduction; LOCATED IN: integral to membrane, membrane;
                     CONTAINS InterPro DOMAIN/s: Ferredoxin reductase-type
                     FAD-binding domain (InterPro:IPR017927), Ferric reductase,
                     NAD binding (InterPro:IPR013121), FAD-binding 8
                     (InterPro:IPR013112), Riboflavin synthase-like beta-barrel
                     (InterPro:IPR017938), Ferric reductase-like transmembrane
                     component, N-terminal (InterPro:IPR013130); BEST
                     Arabidopsis thaliana protein match is: ferric reduction
                     oxidase 3 (TAIR:AT1G23020.2); Has 2645 Blast hits to 2634
                     proteins in 373 species: Archae - 2; Bacteria - 275;
                     Metazoa - 567; Fungi - 1143; Plants - 485; Viruses - 0;
                     Other Eukaryotes - 173 (source: NCBI BLink)."
                     /product="ferric reduction oxidase 1"
     gene            218834..221286
                     /gene_synonym="''cytochrome P450"
                     /gene_synonym="cytochrome P450"
                     /gene_synonym="family 86"
                     /gene_synonym="polypeptide 4"
                     /gene_synonym="polypeptide 4''"
                     /gene_synonym="subfamily A"
                     /note="Encodes a member of the CYP86A subfamily of
                     cytochrome p450 genes. Expressed significantly at highest
                     level in mature stems and flowers."
     mRNA            join(218834..219621,219752..221286)
                     /gene_synonym="''cytochrome P450"
                     /gene_synonym="cytochrome P450"
                     /gene_synonym="family 86"
                     /gene_synonym="polypeptide 4"
                     /gene_synonym="polypeptide 4''"
                     /gene_synonym="subfamily A"
                     /product="cytochrome P450, family 86, subfamily A,
                     polypeptide 4"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AK117400.1"
     CDS             join(219200..219621,219752..220994)
                     /gene_synonym="''cytochrome P450"
                     /gene_synonym="cytochrome P450"
                     /gene_synonym="family 86"
                     /gene_synonym="polypeptide 4"
                     /gene_synonym="polypeptide 4''"
                     /gene_synonym="subfamily A"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence, mRNA:INSD:AK117400.1"
                     /note="''cytochrome P450, family 86, subfamily A,
                     polypeptide 4'' (CYP86A4); CONTAINS InterPro DOMAIN/s:
                     Cytochrome P450 (InterPro:IPR001128), Cytochrome P450,
                     conserved site (InterPro:IPR017972), Cytochrome P450,
                     E-class, group I (InterPro:IPR002401); BEST Arabidopsis
                     thaliana protein match is: cytochrome P450, family 86,
                     subfamily A, polypeptide 2 (TAIR:AT4G00360.1); Has 27858
                     Blast hits to 27767 proteins in 1485 species: Archae - 44;
                     Bacteria - 2493; Metazoa - 10417; Fungi - 6140; Plants -
                     7807; Viruses - 3; Other Eukaryotes - 954 (source: NCBI
                     /product="cytochrome P450, family 86, subfamily A,
                     polypeptide 4"
     gene            complement(221642..224351)
                     /gene_synonym="glycerol-3-phosphate acyltransferase 4"
                     /gene_synonym="GLYCEROL-3-PHOSPHATE ACYLTRANSFERASE 4"
                     /gene_synonym="GLYCEROL-3-PHOSPHATE sn-2-ACYLTRANSFERASE
                     /note="bifunctional sn-glycerol-3-phosphate
                     2-O-acyltransferase/phosphatase. Involved in cutin
                     assembly and is functionally redundant with GPAT8."
     mRNA            complement(join(221642..222359,222622..223096,
                     /gene_synonym="glycerol-3-phosphate acyltransferase 4"
                     /gene_synonym="GLYCEROL-3-PHOSPHATE ACYLTRANSFERASE 4"
                     /gene_synonym="GLYCEROL-3-PHOSPHATE sn-2-ACYLTRANSFERASE
                     /product="glycerol-3-phosphate acyltransferase 4"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             complement(join(221950..222359,222622..223096,
                     /gene_synonym="glycerol-3-phosphate acyltransferase 4"
                     /gene_synonym="GLYCEROL-3-PHOSPHATE ACYLTRANSFERASE 4"
                     /gene_synonym="GLYCEROL-3-PHOSPHATE sn-2-ACYLTRANSFERASE
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
                     /note="glycerol-3-phosphate acyltransferase 4 (GPAT4);
                     FUNCTIONS IN: 1-acylglycerol-3-phosphate O-acyltransferase
                     activity, acyltransferase activity; INVOLVED IN: metabolic
                     process, cutin biosynthetic process; EXPRESSED IN: 25
                     plant structures; EXPRESSED DURING: 14 growth stages;
                     CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol
                     acyltransferase (InterPro:IPR002123); BEST Arabidopsis
                     thaliana protein match is: glycerol-3-phosphate
                     acyltransferase 8 (TAIR:AT4G00400.1); Has 410 Blast hits
                     to 396 proteins in 34 species: Archae - 0; Bacteria - 20;
                     Metazoa - 10; Fungi - 0; Plants - 373; Viruses - 0; Other
                     Eukaryotes - 7 (source: NCBI BLink)."
                     /product="glycerol-3-phosphate acyltransferase 4"
     gene            complement(225665..227543)
                     /gene_synonym="PLASMA MEMBRANE INTRINSIC PROTEIN 1;3"
                     /gene_synonym="plasma membrane intrinsic protein 1C"
                     /note="a member of the plasma membrane intrinsic protein
                     subfamily PIP1. localizes to the plasma membrane and
                     exhibits water transport activity in Xenopus oocyte.
                     expressed ubiquitously and protein level decreases
                     slightly during leaf development."
     mRNA            complement(join(225665..226081,226171..226311,
                     /gene_synonym="PLASMA MEMBRANE INTRINSIC PROTEIN 1;3"
                     /gene_synonym="plasma membrane intrinsic protein 1C"
                     /product="plasma membrane intrinsic protein 1C"
                     /inference="Similar to RNA sequence,
     mRNA            complement(join(225665..226081,226171..226311,
                     /gene_synonym="PLASMA MEMBRANE INTRINSIC PROTEIN 1;3"
                     /gene_synonym="plasma membrane intrinsic protein 1C"
                     /product="plasma membrane intrinsic protein 1C"
                     /inference="Similar to RNA sequence,
                     /inference="similar to RNA sequence,
     CDS             complement(join(225986..226081,226171..226311,
                     /gene_synonym="PLASMA MEMBRANE INTRINSIC PROTEIN 1;3"
                     /gene_synonym="plasma membrane intrinsic protein 1C"
                     /inference="Similar to RNA sequence,