LOCUS BE455654 587 bp mRNA linear EST 22-OCT-2001 DEFINITION HVSMEg0018J22f Hordeum vulgare pre-anthesis spike EST library HVcDNA0008 (white to yellow anther) Hordeum vulgare subsp. vulgare cDNA clone HVSMEg0018J22f, mRNA sequence. ACCESSION BE455654 VERSION BE455654.2 DBLINK BioSample: SAMN00159197 KEYWORDS EST. SOURCE Hordeum vulgare subsp. vulgare (domesticated barley) ORGANISM Hordeum vulgare subsp. vulgare Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; BOP clade; Pooideae; Triticodae; Triticeae; Hordeinae; Hordeum. REFERENCE 1 (bases 1 to 587) AUTHORS Wing,R., Close,T.J., Kleinhofs,A., Wise,R., Begum,D., Frisch,D., Yu,Y., Henry,D., Palmer,M., Rambo,T., Simmons,J., Choi,D.W., Fenton,R.D., Close,S.J., Oates,R. and Main,D. TITLE Development of a genetically and physically anchored EST resource for barley genomics: Morex pre-anthesis spike cDNA library JOURNAL Unpublished COMMENT On Jul 26, 2000 this sequence version replaced BE455654.1. Contact: Wing RA Clemson University Genomics Institute Clemson University 100 Jordan Hall, Clemson, SC 29634, USA Tel: 864 656 7288 Fax: 864 656 4293 Email: rwing@clemson.edu Total hq bases = 363 Seq primer: AATTAACCCTCACTAAAGGG High quality sequence stop: 568. FEATURES Location/Qualifiers source 1..587 /organism="Hordeum vulgare subsp. vulgare" /mol_type="mRNA" /cultivar="Morex" /sub_species="vulgare" /db_xref="taxon:112509" /clone="HVSMEg0018J22f" /tissue_type="pre-anthesis spike" /clone_lib="SAMN00159197 Hordeum vulgare pre-anthesis spike EST library HVcDNA0008 (white to yellow anther)" /lab_host="SOLR" /note="Vector: lambdaZAP; Site_1: EcoR1; Site_2: Xho1; Plants were grown in the greenhouse at the University of California, Riverside (Fenton, SJ Close, TJ Close). Whole spike with awns trimmed were collected at white, green and yellow anther stages (Fenton). Total RNA was prepared from each pool, equal quantities of all three RNA pools were combined, poly(A) RNA was purified from the mixture, one primary unamplified cDNA library was made, and 1 million pfu were in vivo excised to give pBluescript SK(-) cDNA phagemids. These steps were performed in the TJ Close lab (Choi) at the University of California, Riverside. Phagemids were plated and picked at the Clemson University Genomics Institute (CUGI) (Begum, Palmer, Frisch, Atkins and Wing) Plasmid DNA preparations, DNA sequencing and sequence analysis were performed at CUGI (Wing, Yu, Frisch, Henry, Simmons, Oates, Rambo, Main). The sequence has been trimmed to remove vector sequence and contains a minimum of 100 bases of phred value 20 or above. For more details on library preparation and sequence analysis see http://www.genome.clemson.edu/projects/barley. To order this clone see http://www.genome.clemson.edu/orders Also see Close TJ, Wing R, Kleinhofs A, Wise R (2001) Genetically and physically anchored EST resources for barley genomics. Barley Genetics Newsletter 31:29-30. (http://wheat.pw.usda.gov/ggpages/bgn/31/cover.html)" BASE COUNT 144 a 145 c 175 g 123 t ORIGIN 1 gtcacacgaa ctctctcacg tcacacacgc ctcctcctcc tcctcctcct cctgcgagcc 61 agcccagcca ctgggagcgc ccgcggaagc acagagcggg aggagggatc gcgagatgga 121 ctgcaaggat gtcgggatcc tcgccatgga catgtacttc cctcccacct gcgtccagca 181 ggaagcgctg gaggttcatg acggggccag caaggggaag tacacaattg gtcttgggca 241 agactgcatg gccttctgca gcgaggtaga agatgtcatc tcgatgagtt tgacagttgt 301 caaatccctg ctggaaaagt accacataga tccaaagcta attggccgcc tggaggtcgg 361 tagcgagaca gtgatagaca aaagtaaatc catcaaaacg tggctgatgc aaatttttga 421 ggaaagtggt aatactgaca ttgagggagt tgactcgagt aacgcatgtt atggtgggac 481 agctgccctg ttgaactgtg tgaattgggt cgaaagtcga tgctgggatg gacgctacgg 541 ccttgtggtc tgcacagata gcgcggttta tgcagaggga ccagctt //