LOCUS AI462655 306 bp mRNA linear EST 09-MAR-1999 DEFINITION vb59g11.x1 Ko mouse embryo 11 5dpc Mus musculus cDNA clone IMAGE:761348 3', mRNA sequence. ACCESSION AI462655 VERSION AI462655.1 DBLINK BioSample: SAMN00155444 KEYWORDS EST. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 306) AUTHORS Marra,M., Hillier,L., Kucaba,T., Martin,J., Beck,C., Wylie,T., Underwood,K., Steptoe,M., Theising,B., Allen,M., Bowers,Y., Person,B., Swaller,T., Gibbons,M., Pape,D., Harvey,N., Schurk,R., Ritter,E., Kohn,S., Shin,T., Jackson,Y., Cardenas,M., McCann,R., Waterston,R. and Wilson,R. TITLE The WashU-NCI Mouse EST Project 1999 JOURNAL Unpublished COMMENT Contact: Marra M/WashU-NCI Mouse EST Project 1999 Washington University School of Medicine 4444 Forest Park Parkway, Box 8501, St. Louis, MO 63108, USA Tel: 314 286 1800 Fax: 314 286 1810 Email: mouseest@watson.wustl.edu This clone is available royalty-free through LLNL ; contact the IMAGE Consortium (info@image.llnl.gov) for further information. MGI:462268 This clone was previously sequenced on the 5' end only, this new data is from the 3' end Seq primer: Primer name ambiguous. FEATURES Location/Qualifiers source 1..306 /organism="Mus musculus" /mol_type="mRNA" /strain="C57BL/6J" /db_xref="taxon:10090" /clone="IMAGE:761348" /sex="pooled" /tissue_type="embryo" /clone_lib="SAMN00155444 Ko mouse embryo 11 5dpc" /dev_stage="11.5dpc" /lab_host="DH10B" /note="Organ: embryo; Vector: pSPORT1; Site_1: SalI; Site_2: NotI; Total RNAs were extracted from 11.5 dpc embryos (excluding placenta and yolk sac). The double-stranded cDNA was synthesized with an oligo (dT)-1 primer GAGAGAGACTAGTTCTAGATCGCGAGCGGCCGCTTTTTTTTTTTTTTTTTT 3'. The cDNAs were ligated to LL-Sal3A: 5' GCTATTGACGTCGACTATCC 3' and LL-Sal3B: 5' GGATAGTCGACGTCAAT 3'. The cDNAs were size-selected and amplified by long-range PCR using Ex Taq polymerase for 18 cycles. The PCR-amplifiable cDNA mixture went through one round of equalization and was digested with SalI/NotI and cloned into the SalI/NotI sites of the pSPORT1 plasmid vector (Life Technologies). The library was constructed by Dr. Minoru S. H. Ko and Dr. Xiaohong Wang." BASE COUNT 101 a 76 c 41 g 88 t ORIGIN 1 ttttttctgt gtataacttt tatttccaat atagtaaata aagcaaaata aaaaccatta 61 agaaattttg acagcatcta cccatttttc ttttctataa accccaaagt ggtgtgacaa 121 ttcctttgcc cacatactca agtcttggag tacttaaaaa gtcaaaactc acgaatgctg 181 ctaataagaa agtctgaaat ggtactgccc ttcacccaga aatagcacac actgagcctc 241 attatccaag gggagaaaag ctggctccta gaacatattc cctcccctca cccacctccc 301 ctttga //