LOCUS       AB721393                 714 bp    DNA     linear   PLN 23-MAY-2012
DEFINITION  Ophiopogon japonicus genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2,
            26S rRNA, partial and complete sequence.
ACCESSION   AB721393
VERSION     AB721393.1
KEYWORDS    .
SOURCE      Ophiopogon japonicus
  ORGANISM  Ophiopogon japonicus
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; Liliopsida; Asparagales;
            Asparagaceae; Nolinoideae; Ophiopogon.
REFERENCE   1  (bases 1 to 714)
  AUTHORS   Zhu,S. and Komatsu,K.
  TITLE     Direct Submission
  JOURNAL   Submitted (18-MAY-2012) to the DDBJ/EMBL/GenBank databases.
            Contact:Katsuko Komatsu
            Institute of Natural Medicine, University of Toyama, Department of
            Medicinal Resources; 2630 Sugitani, Toyama, Toyama 930-0194, Japan
REFERENCE   2  
  AUTHORS   Ebihara,A., Zhu,S. and Komatsu,K.
  TITLE     Identification of herbal drugs by DNA sequence
  JOURNAL   Unpublished (2012)
COMMENT     
FEATURES             Location/Qualifiers
     source          1..714
                     /db_xref="taxon:100506"
                     /mol_type="genomic DNA"
                     /organism="Ophiopogon japonicus"
                     /PCR_primers="fwd_seq: tccactgaaccttatcatttag, rev_seq:
                     tcctccgcttattgatatgc"
     misc_RNA        <1..>714
                     /note="contains 18S ribosomal RNA, internal transcribed
                     spacer 1, 5.8S ribosomal RNA, internal transcribed spacer
                     2 and 26S ribosomal RNA"
BASE COUNT          136 a          225 c          242 g          110 t
ORIGIN      
        1 aggaaggaga agtcgtaaca aggtttccgt aggtgaacct gcggaaggat cattgtcgag
       61 acccgaacag acgattgcga actcgtaaac gctcctgcag gggcggaggg agggcgcgga
      121 tattccgacc gcccgatctc ggtaccgcgg ggcaccatgg ccgcccccgc cccgcattgc
      181 tgcgggacgg gcggcgggaa caacacccgg cgcgatgggc gccaaggaac aatgctttgt
      241 cggagagcgt cgcgtgccgg tcttggcgcg cagcgtgatc cttccatacg tcgaaccttt
      301 acgactctcg gcaacggata tcttggctct cgcatcgatg aagaacgtag cgaaatgcga
      361 tacttggtgt gaattgcaga atcccgtgaa ccatcgagtc tttgaacgca agttgcgccc
      421 gaggctatcc ggccgagggc acgcctgcct gggcgtcacg cctcgcgtcg ctccgtgcac
      481 cccgtcccga kgaggcggcg ggtgcggatg cggagattgg ccccccgtgc ctgacggcgc
      541 ggcgggtcga agtgcgtacc gccggtcggg acggacgcgg cgagtggtgg acggacacgt
      601 acggcgctga acgtcgcctc cgccccccgg ccacggcggt acatgcaagg aacccacgcc
      661 gagcatccct cggaacacga ccccaggtca ggcggggcca cccgctgagc ttaa
//