LOCUS       AB690805                 658 bp    DNA     linear   PLN 06-JAN-2012
DEFINITION  Bupleurum chinense genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2 and
            26S rRNA.
ACCESSION   AB690805
VERSION     AB690805.1
KEYWORDS    .
SOURCE      Bupleurum chinense
  ORGANISM  Bupleurum chinense
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliophyta; eudicotyledons; Gunneridae;
            Pentapetalae; asterids; campanulids; Apiales; Apiaceae; Apioideae;
            Bupleureae; Bupleurum.
REFERENCE   1  (bases 1 to 658)
  AUTHORS   Zhu,S. and Komatsu,K.
  TITLE     Direct Submission
  JOURNAL   Submitted (04-JAN-2012) to the DDBJ/EMBL/GenBank databases.
            Contact:Katsuko Komatsu
            Institute of Natural Medicine, University of Toyama, Department of
            Medicinal Resources; 2630 Sugitani, Toyama, Toyama 930-0194, Japan
REFERENCE   2
  AUTHORS   Wu,Y., Zhu,S. and Komatsu,K.
  TITLE     Identification of herbal drugs by DNA sequence
  JOURNAL   Unpublished (2011)
COMMENT     
FEATURES             Location/Qualifiers
     source          1..658
                     /db_xref="taxon:52451"
                     /mol_type="genomic DNA"
                     /organism="Bupleurum chinense"
                     /PCR_primers="fwd_seq: tccactgaaccttatcatttag, rev_seq:
                     ccatgcttaaactcagcgggt"
     misc_RNA        <1..>658
                     /note="Contains partial 18S ribosomal RNA gene, internal
                     transcribed spacer 1, 5.8S ribosomal RNA gene, internal
                     transcribed spacer 2, and partial 26S ribosomal RNA gene"
BASE COUNT          143 a          188 c          201 g          126 t
ORIGIN      
        1 cgtaggtgaa cctgcggaag gatcattgtc gaatcctgaa tcgaagagcg acccgagaac
       61 atgtttttag acggggccag cggtcgtcgg cctcggcccg acggctgcga accctaggcc
      121 ggggggcgcc cagttgtgcc cgccggccca aaacctaacc gggcgcggaa tgcgccaagg
      181 aaaccgaaac tgaacaggat gcctccgccc cgtttggggg gggtcgacat ccttctgaga
      241 aacaaacgac tctcggcaac ggatatcccg gctctcgcat cgatgaagaa cgtagcgaaa
      301 tgcgatactt ggtgtgaatt gcagaatccc gtgaaccatc gagtttttga acgcaagttg
      361 cgcccgatgc cattaggctg agggcacgtc tgcctgggtg tcacgtaaag cattgcccct
      421 ccgcagctcg ctcaaggcga gtcgttgctg ttcgggggga cggaaagtga cctcccgtgc
      481 ctcgtcgtgc ggctggttta aaagagagtc accggagatc ggaaaacgca acattggtgg
      541 aagtcgttac gcacctcttg ccatattgcg ctgagcccgt ttactctgtg agcaaaatcg
      601 accctttggc gccgccccag gtgcgcgctc aaactgtgac cccaggtcag gcgggact
//