LOCUS       AB571154                 679 bp    DNA     linear   PLN 14-JUN-2013
DEFINITION  Sinomenium acutum genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 26S
            rRNA, partial and complete sequence.
ACCESSION   AB571154
VERSION     AB571154.1
KEYWORDS    .
SOURCE      Sinomenium acutum
  ORGANISM  Sinomenium acutum
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliophyta; eudicotyledons; Ranunculales;
            Menispermaceae; Menispermoideae; Menispermeae; Sinomenium.
REFERENCE   1  (bases 1 to 679)
  AUTHORS   Zhu,S. and Komatsu,K.
  TITLE     Direct Submission
  JOURNAL   Submitted (07-JUL-2010) to the DDBJ/EMBL/GenBank databases.
            Contact:Katsuko Komatsu
            Institute of Natural Medicine, University of Toyama, Department of
            Medicinal Resources; 2630 Sugitani, Toyama, Toyama 930-0194, Japan
REFERENCE   2
  AUTHORS   Wu,Y., Zhu,S. and Komatsu,K.
  TITLE     Identification of herbal drugs by DNA sequences
  JOURNAL   Unpublished (2011)
COMMENT     
FEATURES             Location/Qualifiers
     source          1..679
                     /db_xref="taxon:152363"
                     /mol_type="genomic DNA"
                     /organism="Sinomenium acutum"
                     /PCR_primers="fwd_seq: tccactgaaccttatcatttag, rev_seq:
                     ccatgcttaaactcagcgggt"
     misc_RNA        <1..>679
                     /note="contains 18S ribosomal RNA, internal transcribed
                     spacer 1, 5.8S ribosomal RNA, internal transcribed spacer
                     2, and 26S ribosomal RNA"
BASE COUNT          176 a          158 c          187 g          157 t
ORIGIN      
        1 aggaaggaga agtcgtaaca aggtttccgt aggtgaacct gcggaaggat cattgtcgaa
       61 acctgcaaag cagaatgacc agtgaatcgg ttgcactacc acacgactgg agttatggag
      121 ccttaaaatc ctacacttgc attcgtgtaa ttgaagggag gagaggcttc tgtagcttct
      181 gttacaacaa caaaactcgg cgcatcttgt gccaaggaaa tgacaatgga ttagatgtgc
      241 atccttacgg ctagctagct agcttgttgg atgttatcag taatctctat tcttgaacga
      301 ctctcggcaa cggatatctc ggctctcgca tcgatgaaga acgtagcgaa atgcgatact
      361 tggtgtgaat tgcagaatcc cgtgaaccat cgagtctttg aacgcaagtt gcgcctgagg
      421 ccatcaggtc gagggcacgc ctgcctgggc gtcctgcatt gcgccactcc caacccaagg
      481 ggagggagtg aaattggcct cccgtgactc gtgtgcggac ggctgaaaaa gttgcccgtt
      541 ggtggcatgc actacgcgat cagtggtggt tgacaaaacc cattcaccga aataggatga
      601 cttgatcgag tagttgccat cgagggtaaa ttgaaccctt gtagctcmta taccatgcga
      661 ccccaggtca ggcggggac
//