LOCUS AB469167 214 bp DNA linear PLN 02-APR-2009 DEFINITION Prunus persica chloroplast DNA, rpL16 intron, specimen_voucher: THS:75574. ACCESSION AB469167 VERSION AB469167.1 KEYWORDS . SOURCE chloroplast Prunus persica (peach) ORGANISM Prunus persica Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; fabids; Rosales; Rosaceae; Amygdaloideae; Amygdaleae; Prunus. REFERENCE 1 (bases 1 to 214) AUTHORS Yamaji,H., Kondo,K., Miki,E., Iketani,H., Yamaguchi,M. and Takeda,O. TITLE Direct Submission JOURNAL Submitted (30-OCT-2008) to the DDBJ/EMBL/GenBank databases. Contact:Hiroki Yamaji Tsumura & Co., Botanical Raw Material Research Dept.; 3586 Yoshiwara, Inashiki, Ami-machi, Ibaraki 300-1192, Japan REFERENCE 2 AUTHORS Yamaji,H., Kondo,K., Miki,E., Iketani,H., Yamaguchi,M. and Takeda,O. TITLE Discrimination of Xingren derived from Prunus sect. Armeniaca (Rosaceae)species by the partial rpl16 intron sequences of cpDNA, and the botanical origin of Xingrens in markets in Japan JOURNAL Unpublished (2009) COMMENT FEATURES Location/Qualifiers source 1..214 /collected_by="Hiroki Yamaji" /collection_date="2004-04-07" /country="Japan:Ibaraki" /db_xref="taxon:3760" /identified_by="Hiroki Yamaji" /mol_type="genomic DNA" /organelle="plastid:chloroplast" /organism="Prunus persica" /PCR_primers="fwd_name: rpl16/F, fwd_seq: GTTTCTTCTCATCCAGCTCC, rev_name: rpl16/R, rev_seq: GAAAGAGTCAATATTCGCCC" /specimen_voucher="THS:75574" intron <1..>214 /note="rpl16 intron" BASE COUNT 70 a 22 c 21 g 101 t ORIGIN 1 tacacggtga ataatatacg gaatcatggt attcttttaa attttatcta atctatatct 61 attataaatt ttaaattttt tgtgttttaa tatataatta aacacgtctt ctatttatag 121 ataatgtggt ttttatataa cgttatcgtt ataatgaatc tttattttct ttttcctttg 181 tattatcata tcgaatcgac taaaatttag aaat //