LOCUS AB469165 222 bp DNA linear PLN 02-APR-2009 DEFINITION Prunus mandshurica chloroplast DNA, rpL16 intron, specimen_voucher: THS:73755. ACCESSION AB469165 VERSION AB469165.1 KEYWORDS . SOURCE chloroplast Prunus mandshurica ORGANISM Prunus mandshurica Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; fabids; Rosales; Rosaceae; Amygdaloideae; Amygdaleae; Prunus. REFERENCE 1 (bases 1 to 222) AUTHORS Yamaji,H., Kondo,K., Miki,E., Iketani,H., Yamaguchi,M. and Takeda,O. TITLE Direct Submission JOURNAL Submitted (30-OCT-2008) to the DDBJ/EMBL/GenBank databases. Contact:Hiroki Yamaji Tsumura & Co., Botanical Raw Material Research Dept.; 3586 Yoshiwara, Inashiki, Ami-machi, Ibaraki 300-1192, Japan REFERENCE 2 AUTHORS Yamaji,H., Kondo,K., Miki,E., Iketani,H., Yamaguchi,M. and Takeda,O. TITLE Discrimination of Xingren derived from Prunus sect. Armeniaca (Rosaceae)species by the partial rpl16 intron sequences of cpDNA, and the botanical origin of Xingrens in markets in Japan JOURNAL Unpublished (2009) COMMENT FEATURES Location/Qualifiers source 1..222 /collected_by="Youchang Zhu" /collection_date="2003-08-02" /country="China:Jilin" /db_xref="taxon:122122" /identified_by="Youchang Zhu" /mol_type="genomic DNA" /organelle="plastid:chloroplast" /organism="Prunus mandshurica" /PCR_primers="fwd_name: rpl16/F, fwd_seq: GTTTCTTCTCATCCAGCTCC, rev_name: rpl16/R, rev_seq: GAAAGAGTCAATATTCGCCC" /specimen_voucher="THS:73755" intron <1..>222 /note="rpl16 intron" BASE COUNT 73 a 24 c 21 g 104 t ORIGIN 1 tacacggtga ataatatacg gaatcgtggt attcttttaa attttatcta atctatatct 61 attataaatt taaaattttt tgtgttttaa tatataatta aacacgtctt ctatttatag 121 ataatgtcgt ttttatataa cgttatcgtt ataatgaatc tttattttct ttttcctttg 181 tattatcata ttatcatatc gaatcgacta aaatttagaa at //