LOCUS AB469163 214 bp DNA linear PLN 02-APR-2009 DEFINITION Prunus armeniaca chloroplast DNA, rpL16 intron, specimen_voucher: THS:75420. ACCESSION AB469163 VERSION AB469163.1 KEYWORDS . SOURCE chloroplast Prunus armeniaca (apricot) ORGANISM Prunus armeniaca Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; fabids; Rosales; Rosaceae; Amygdaloideae; Amygdaleae; Prunus. REFERENCE 1 (bases 1 to 214) AUTHORS Yamaji,H., Kondo,K., Miki,E., Iketani,H., Yamaguchi,M. and Takeda,O. TITLE Direct Submission JOURNAL Submitted (30-OCT-2008) to the DDBJ/EMBL/GenBank databases. Contact:Hiroki Yamaji Tsumura & Co., Botanical Raw Material Research Dept.; 3586 Yoshiwara, Inashiki, Ami-machi, Ibaraki 300-1192, Japan REFERENCE 2 AUTHORS Yamaji,H., Kondo,K., Miki,E., Iketani,H., Yamaguchi,M. and Takeda,O. TITLE Discrimination of Xingren derived from Prunus sect. Armeniaca (Rosaceae)species by the partial rpl16 intron sequences of cpDNA, and the botanical origin of Xingrens in markets in Japan JOURNAL Unpublished (2009) COMMENT FEATURES Location/Qualifiers source 1..214 /collected_by="Hiroki Yamaji" /collection_date="2004-06-01" /country="China:Neimenggu" /db_xref="taxon:36596" /identified_by="Hiroki Yamaji" /mol_type="genomic DNA" /organelle="plastid:chloroplast" /organism="Prunus armeniaca" /PCR_primers="fwd_name: rpl16/F, fwd_seq: GTTTCTTCTCATCCAGCTCC, rev_name: rpl16/R, rev_seq: GAAAGAGTCAATATTCGCCC" /specimen_voucher="THS:75420" intron <1..>214 /note="rpl16 intron" BASE COUNT 70 a 22 c 21 g 101 t ORIGIN 1 tacacggtga ataatatacg gaatcgtggt attcttttaa attttatcta atctatatct 61 attataaatt ttaaatttat tgtgttttaa tatataatta aacatgtctt ctatttatag 121 ataatgtcgt ttttatataa cgttatcgtt ataatgaatc tttattttct ttttcctttg 181 tattatcata tcgaatcgac taaaatttag aaat //