LOCUS AA437664 552 bp mRNA linear EST 30-MAY-1997 DEFINITION ve31b11.r1 Ko mouse embryo 11 5dpc Mus musculus cDNA clone IMAGE:819741 5', mRNA sequence. ACCESSION AA437664 VERSION AA437664.1 DBLINK BioSample: SAMN00155444 KEYWORDS EST. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 552) AUTHORS Marra,M., Hillier,L., Allen,M., Bowles,M., Dietrich,N., Dubuque,T., Geisel,S., Kucaba,T., Lacy,M., Le,M., Martin,J., Morris,M., Schellenberg,K., Steptoe,M., Tan,F., Underwood,K., Moore,B., Theising,B., Wylie,T., Lennon,G., Soares,B., Wilson,R. and Waterston,R. TITLE The WashU-HHMI Mouse EST Project JOURNAL Unpublished COMMENT Contact: Marra M/Mouse EST Project WashU-HHMI Mouse EST Project Washington University School of MedicineP 4444 Forest Park Parkway, Box 8501, St. Louis, MO 63108 Tel: 314 286 1800 Fax: 314 286 1810 Email: mouseest@watson.wustl.edu This clone is available royalty-free through LLNL ; contact the IMAGE Consortium (info@image.llnl.gov) for further information. MGI:488021 High quality sequence stop: 477. FEATURES Location/Qualifiers source 1..552 /organism="Mus musculus" /mol_type="mRNA" /strain="C57BL/6J" /db_xref="taxon:10090" /clone="IMAGE:819741" /sex="pooled" /tissue_type="embryo" /clone_lib="SAMN00155444 Ko mouse embryo 11 5dpc" /dev_stage="11.5dpc" /lab_host="DH10B" /note="Organ: embryo; Vector: pSPORT1; Site_1: SalI; Site_2: NotI; Total RNAs were extracted from 11.5 dpc embryos (excluding placenta and yolk sac). The double-stranded cDNA was synthesized with an oligo (dT)-1 primer GAGAGAGACTAGTTCTAGATCGCGAGCGGCCGCTTTTTTTTTTTTTTTTTT 3'. The cDNAs were ligated to LL-Sal3A: 5' GCTATTGACGTCGACTATCC 3' and LL-Sal3B: 5' GGATAGTCGACGTCAAT 3'. The cDNAs were size-selected and amplified by long-range PCR using Ex Taq polymerase for 18 cycles. The PCR-amplifiable cDNA mixture went through one round of equalization and was digested with SalI/NotI and cloned into the SalI/NotI sites of the pSPORT1 plasmid vector (Life Technologies). The library was constructed by Dr. Minoru S. H. Ko and Dr. Xiaohong Wang." BASE COUNT 149 a 118 c 120 g 165 t ORIGIN 1 ctacaggctg gtggggaaag caggctttga acaggagtta caagttgtag catgtgcttt 61 gtagatgaaa gccacaaaat gccacctgga ttttgattga caagactgac tgaatccttc 121 tgtctgtccc tgccctgtgt tagtctggtc tgtaccctct tagcctcttt aatcttcctt 181 ctgtctcctg gaccacctgc tgattaccag atagtatggc ctagagttaa tagaatggac 241 agatctggtt ttcagggttg gccttttcgc ttagtttggt ctagtccaat ttttaatctg 301 agaagcgggt aactggggaa acggctcagt gattgggagc actagctact cttgcaaaga 361 acccagattc aattcctaac atctatatgg ttactcaaca gttccagagt atccctttcc 421 cggccttgga gggaccaggc aaacgcatgg tacacagaca tgcagataaa acacccatgc 481 atataaaaca tttttaaata attttaagtc tgagttttgg ttgctaattt atgaaatgaa 541 aacaattcca ac //