LOCUS       LC600319                 600 bp    DNA     linear   PLN 01-JUN-2021
DEFINITION  Trichoderma harzianum THIF08 genes for ITS1, 5.8S rRNA, ITS2,
            partial and complete sequence.
ACCESSION   LC600319
VERSION     LC600319.1
KEYWORDS    .
SOURCE      Trichoderma harzianum
  ORGANISM  Trichoderma harzianum
            Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
            Sordariomycetes; Hypocreomycetidae; Hypocreales; Hypocreaceae;
            Trichoderma.
REFERENCE   1  (bases 1 to 600)
  AUTHORS   Masaki,Y., Katayama,Y. and Matsushita,Y.
  TITLE     Direct Submission
  JOURNAL   Submitted (08-JAN-2021) to the DDBJ/EMBL/GenBank databases.
            Contact:Yoshihito Masaki
            Tokyo University of Agriculture and Technology, Gene Research
            Center; 3-5-8 Saiwai-cho, Fuchu, Tokyo 183-8509, Japan
REFERENCE   2
  AUTHORS   Masaki,Y., Iizuka,R., Kato,H., Kojima,Y., Ogawa,T., Yoshida,M.,
            Matsushita,Y. and Katayama,Y.
  TITLE     Fungal Carbonyl Sulfide Hydrolase of Trichoderma harzianum Strain
            THIF08 and Its Relationship with Clade D beta-Carbonic Anhydrases
  JOURNAL   Microbes Environ. 36, ME20058 (2021)
  REMARK    Publication Status: Online-Only
            DOI:10.1264/jsme2.ME20058
COMMENT     
FEATURES             Location/Qualifiers
     source          1..600
                     /collected_by="Yoko Katayama"
                     /country="Japan: Tochigi, Karasawa-yama area"
                     /db_xref="taxon:5544"
                     /isolation_source="forest soil"
                     /mol_type="genomic DNA"
                     /organism="Trichoderma harzianum"
                     /PCR_primers="fwd_name: ITS5_primer, fwd_seq:
                     ggaagtaaaagtcgtaacaagg, rev_name: ITS4_primer, rev_seq:
                     tcctccgcttattgatatgc"
                     /strain="THIF08"
     misc_RNA        <1..>600
                     /note="contains internal transcribed spacer 1, 5.8S
                     ribosomal RNA, internal transcribed spacer 2"
BASE COUNT          131 a          178 c          155 g          136 t
ORIGIN      
        1 tctccgttgg tgaaccagcg gagggatcat taccgagttt acaactccca aacccaatgt
       61 gaacgttacc aaactgttgc ctcggcggga tctctgcccc gggtgcgtcg cagccccgga
      121 ccaaggcgcc cgccggagga ccaaccaaaa ctctttttgt ataccccctc gcgggttttt
      181 tataatctga gccttctcgg cgcctctcgt aggcgtttcg aaaatgaatc aaaactttca
      241 acaacggatc tcttggttct ggcatcgatg aagaacgcag cgaaatgcga taagtaatgt
      301 gaattgcaga attcagtgaa tcatcgaatc tttgaacgca cattgcgccc gccagtattc
      361 tggcgggcat gcctgtccga gcgtcatttc aaccctcgaa cccctccggg gggtcggcgt
      421 tggggatcgg ccctgcctct ggcggtggcc gtctccgaaa tacagtggcg gtctcgccgc
      481 agcctctcct gcgcagtagt ttgcacactc gcatcgggag cgcggcgcgt ccacagccgt
      541 taaacaccca acttctgaaa tgttgacctc ggatcaggta ggaatacccg ctgaacttaa
//