LOCUS LC600319 600 bp DNA linear PLN 01-JUN-2021 DEFINITION Trichoderma harzianum THIF08 genes for ITS1, 5.8S rRNA, ITS2, partial and complete sequence. ACCESSION LC600319 VERSION LC600319.1 KEYWORDS . SOURCE Trichoderma harzianum ORGANISM Trichoderma harzianum Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Sordariomycetes; Hypocreomycetidae; Hypocreales; Hypocreaceae; Trichoderma. REFERENCE 1 (bases 1 to 600) AUTHORS Masaki,Y., Katayama,Y. and Matsushita,Y. TITLE Direct Submission JOURNAL Submitted (08-JAN-2021) to the DDBJ/EMBL/GenBank databases. Contact:Yoshihito Masaki Tokyo University of Agriculture and Technology, Gene Research Center; 3-5-8 Saiwai-cho, Fuchu, Tokyo 183-8509, Japan REFERENCE 2 AUTHORS Masaki,Y., Iizuka,R., Kato,H., Kojima,Y., Ogawa,T., Yoshida,M., Matsushita,Y. and Katayama,Y. TITLE Fungal Carbonyl Sulfide Hydrolase of Trichoderma harzianum Strain THIF08 and Its Relationship with Clade D beta-Carbonic Anhydrases JOURNAL Microbes Environ. 36, ME20058 (2021) REMARK Publication Status: Online-Only DOI:10.1264/jsme2.ME20058 COMMENT FEATURES Location/Qualifiers source 1..600 /collected_by="Yoko Katayama" /country="Japan: Tochigi, Karasawa-yama area" /db_xref="taxon:5544" /isolation_source="forest soil" /mol_type="genomic DNA" /organism="Trichoderma harzianum" /PCR_primers="fwd_name: ITS5_primer, fwd_seq: ggaagtaaaagtcgtaacaagg, rev_name: ITS4_primer, rev_seq: tcctccgcttattgatatgc" /strain="THIF08" misc_RNA <1..>600 /note="contains internal transcribed spacer 1, 5.8S ribosomal RNA, internal transcribed spacer 2" BASE COUNT 131 a 178 c 155 g 136 t ORIGIN 1 tctccgttgg tgaaccagcg gagggatcat taccgagttt acaactccca aacccaatgt 61 gaacgttacc aaactgttgc ctcggcggga tctctgcccc gggtgcgtcg cagccccgga 121 ccaaggcgcc cgccggagga ccaaccaaaa ctctttttgt ataccccctc gcgggttttt 181 tataatctga gccttctcgg cgcctctcgt aggcgtttcg aaaatgaatc aaaactttca 241 acaacggatc tcttggttct ggcatcgatg aagaacgcag cgaaatgcga taagtaatgt 301 gaattgcaga attcagtgaa tcatcgaatc tttgaacgca cattgcgccc gccagtattc 361 tggcgggcat gcctgtccga gcgtcatttc aaccctcgaa cccctccggg gggtcggcgt 421 tggggatcgg ccctgcctct ggcggtggcc gtctccgaaa tacagtggcg gtctcgccgc 481 agcctctcct gcgcagtagt ttgcacactc gcatcgggag cgcggcgcgt ccacagccgt 541 taaacaccca acttctgaaa tgttgacctc ggatcaggta ggaatacccg ctgaacttaa //