LOCUS       JQ291233                 629 bp    DNA     linear   INV 24-APR-2012
DEFINITION  Anopheles homunculus isolate BA22_31 cytochrome c oxidase subunit I
            (COI) gene, partial cds; mitochondrial.
VERSION     JQ291233.1
SOURCE      mitochondrion Anopheles homunculus
  ORGANISM  Anopheles homunculus
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Holometabola; Diptera; Nematocera; Culicoidea;
            Culicidae; Anophelinae; Anopheles.
REFERENCE   1  (bases 1 to 629)
  AUTHORS   da Cardoso,J.C., Bergo,E.S., Oliveira,T.M., Sant'ana,D.C.,
            Motoki,M.T. and Sallum,M.A.
  TITLE     New records of Anopheles homunculus in central and serra do mar
            biodiversity corridors of the Atlantic Forest, Brazil
  JOURNAL   J. Am. Mosq. Control Assoc. 28 (1), 1-5 (2012)
   PUBMED   22533076
REFERENCE   2  (bases 1 to 629)
  AUTHORS   Cardoso,J.C., Bergo,E.S., Oliveira,T.M.P., Sant'Ana,D.C.,
            Motoki,M.T. and Sallum,M.A.M.
  TITLE     Direct Submission
  JOURNAL   Submitted (15-DEC-2011) Epidemiologia, Faculdade de Saude Publica,
            Universidade de Sao Paulo, Avenida Doutor Arnaldo 715, Sao Paulo,
            Sao Paulo 01246904, Brazil
FEATURES             Location/Qualifiers
     source          1..629
                     /organism="Anopheles homunculus"
                     /mol_type="genomic DNA"
                     /country="Brazil: Bahia state, Camacan, Reserva Serra
                     /collected_by="Sallum MAM and Bergo ES"
                     /PCR_primers="fwd_name: LCO1490, fwd_seq:
                     ggtcaacaaatcataaagatattg, rev_name: HCO2198, rev_seq:
                     /note="larval and pupal exuviae, male genitilia kept as
     gene            <1..>629
     CDS             <1..>629
                     /product="cytochrome c oxidase subunit I"
BASE COUNT          174 a           99 c          102 g          254 t
        1 tgagctggaa tagtcggaac ttctctaaga attttaattc gagctgaatt aggacatcct
       61 ggtgctttta ttggagatga ccaaatttat aatgttattg ttactgctca tgcttttatt
      121 ataatttttt ttatagttat gcctattata attggaggat tcggaaattg attagttcct
      181 ctaatattag gagcacctga tatagctttt cctcgaataa ataatataag attttgaata
      241 ttaccccctt ctttaactct tttagtttca agaagtatag tagaaagtgg ggctggaaca
      301 ggttgaactg tttaccctcc tttatcttct ggaattgctc acgctggagc ttctgtagat
      361 ttagcaattt tttctttaca tttagccggt atttcttcta ttttaggagc agtaaatttt
      421 attactacag ttattaatat acgttctcct ggaattacat tagatcgaat acctttattt
      481 gtatgatcag tagttattac tgcaattcta ttacttttat ctttacctgt tttagcagga
      541 gctattacta tacttttaac tgatcgaaat ttaaatactt cattttttga ccctgcaggt
      601 ggaggagacc caattttata ccaacattt

LOCUS       JQ291234                 605 bp    DNA     linear   INV 24-APR-2012
DEFINITION  Anopheles homunculus isolate BA22_33 cytochrome c oxidase subunit I
            (COI) gene, partial cds; mitochondrial.
VERSION     JQ291234.1
SOURCE      mitochondrion Anopheles homunculus
  ORGANISM  Anopheles homunculus
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Holometabola; Diptera; Nematocera; Culicoidea;
            Culicidae; Anophelinae; Anopheles.
REFERENCE   1  (bases 1 to 605)
  AUTHORS   da Cardoso,J.C., Bergo,E.S., Oliveira,T.M., Sant'ana,D.C.,
            Motoki,M.T. and Sallum,M.A.
  TITLE     New records of Anopheles homunculus in central and serra do mar
            biodiversity corridors of the Atlantic Forest, Brazil
  JOURNAL   J. Am. Mosq. Control Assoc. 28 (1), 1-5 (2012)
   PUBMED   22533076
REFERENCE   2  (bases 1 to 605)
  AUTHORS   Cardoso,J.C., Bergo,E.S., Oliveira,T.M.P., Sant'Ana,D.C.,
            Motoki,M.T. and Sallum,M.A.M.
  TITLE     Direct Submission
  JOURNAL   Submitted (15-DEC-2011) Epidemiologia, Faculdade de Saude Publica,
            Universidade de Sao Paulo, Avenida Doutor Arnaldo 715, Sao Paulo,
            Sao Paulo 01246904, Brazil
FEATURES             Location/Qualifiers
     source          1..605
                     /organism="Anopheles homunculus"
                     /mol_type="genomic DNA"
                     /country="Brazil: Bahia state, Camacan, Reserva Serra
                     /collected_by="Sallum MAM and Bergo ES"
                     /PCR_primers="fwd_name: LCO1490, fwd_seq:
                     ggtcaacaaatcataaagatattg, rev_name: HCO2198, rev_seq:
                     /note="larval and pupal exuviae kept as vouchers"
     gene            <1..>605
     CDS             <1..>605
                     /product="cytochrome c oxidase subunit I"
BASE COUNT          168 a           91 c          100 g          246 t
        1 gctggaatag tcggaacttc tctaagaatt ttaattcgag ctgaattagg acatcctggt
       61 gcttttattg gagatgacca aatttataat gttattgtta ctgctcatgc ttttattata
      121 atttttttta tagttatgcc tattataatt ggaggattcg gaaattgatt agttcctcta
      181 atattaggag cacctgatat agcttttcct cgaataaata atataagatt ttgaatatta
      241 cccccttctt taactctttt agtttcaaga agtatagtag aaaatggggc tggaacaggt
      301 tgaactgttt atcctccttt atcttctgga attgctcacg ctggagcttc tgtagattta
      361 gcaatttttt ctttacattt agctggtatt tcttctattt taggagcagt aaattttatt
      421 actacagtta ttaatatacg ttctcctgga attacactag atcgaatacc tttatttgta
      481 tgatcagtag ttattactgc aattttatta cttttatctt tacctgtttt agcaggagct
      541 attactatac ttttaactga tcgaaattta aatacttcat tttttgaccc tgcaggagga
      601 ggaga

LOCUS       JQ291235                 669 bp    DNA     linear   INV 24-APR-2012
DEFINITION  Anopheles homunculus isolate ES10_2 cytochrome c oxidase subunit I
            (COI) gene, partial cds; mitochondrial.
VERSION     JQ291235.1
SOURCE      mitochondrion Anopheles homunculus
  ORGANISM  Anopheles homunculus
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Holometabola; Diptera; Nematocera; Culicoidea;
            Culicidae; Anophelinae; Anopheles.
REFERENCE   1  (bases 1 to 669)
  AUTHORS   da Cardoso,J.C., Bergo,E.S., Oliveira,T.M., Sant'ana,D.C.,
            Motoki,M.T. and Sallum,M.A.
  TITLE     New records of Anopheles homunculus in central and serra do mar
            biodiversity corridors of the Atlantic Forest, Brazil
  JOURNAL   J. Am. Mosq. Control Assoc. 28 (1), 1-5 (2012)
   PUBMED   22533076
REFERENCE   2  (bases 1 to 669)
  AUTHORS   Cardoso,J.C., Bergo,E.S., Oliveira,T.M.P., Sant'Ana,D.C.,
            Motoki,M.T. and Sallum,M.A.M.
  TITLE     Direct Submission
  JOURNAL   Submitted (15-DEC-2011) Epidemiologia, Faculdade de Saude Publica,
            Universidade de Sao Paulo, Avenida Doutor Arnaldo 715, Sao Paulo,
            Sao Paulo 01246904, Brazil
FEATURES             Location/Qualifiers
     source          1..669
                     /organism="Anopheles homunculus"
                     /mol_type="genomic DNA"
                     /country="Brazil: Espirito Santo state, Santa Teresa
                     /collected_by="Sallum MAM and Bergo ES"
                     /PCR_primers="fwd_name: LCO1490, fwd_seq:
                     ggtcaacaaatcataaagatattg, rev_name: HCO2198, rev_seq:
                     /note="larval and pupal exuviae, male genitilia kept as
     gene            <1..>669
     CDS             <1..>669
                     /product="cytochrome c oxidase subunit I"
BASE COUNT          181 a           99 c          112 g          277 t
        1 gatattggta ctttatattt tatttttggg gcatgagctg ggatagtcgg aacttctcta
       61 agaattttaa ttcgagctga attaggtcat tctggtgctt ttattggaga tgaccaaatt
      121 tataatgtta ttgttactgc tcatgctttt attataattt tttttatagt tatgcctatt
      181 ataattggag gattcggaaa ttgattagtt cctctaatat taggagcacc tgatatagct
      241 tttcctcgaa taaataatat aagattttga atattacccc cttctttaac tcttttagtt
      301 tcaagaagta tagtagaaaa tggggctgga acaggttgaa ctgtttatcc tcctttatct
      361 tctggaattg ctcacgctgg ggcttctgta gatttagcaa ttttttcttt acatttagct
      421 ggtatttctt ctattttagg agcagtaaat tttattacta cagttattaa tatacggtct
      481 cctggaatta cactagatcg aataccttta tttgtatgat cagtagttat tactgcaatt
      541 ctattacttt tatctttacc tgttttagca ggagctatta ctatactttt aactgatcga
      601 aatttaaata cttcattttt tgaccctgca ggtggaggag acccaatttt ataccaacat
      661 ttattttga

LOCUS       JQ291236                 636 bp    DNA     linear   INV 24-APR-2012
DEFINITION  Anopheles homunculus isolate RS20_21 cytochrome c oxidase subunit I
            (COI) gene, partial cds; mitochondrial.
VERSION     JQ291236.1
SOURCE      mitochondrion Anopheles homunculus
  ORGANISM  Anopheles homunculus
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Holometabola; Diptera; Nematocera; Culicoidea;
            Culicidae; Anophelinae; Anopheles.
REFERENCE   1  (bases 1 to 636)
  AUTHORS   da Cardoso,J.C., Bergo,E.S., Oliveira,T.M., Sant'ana,D.C.,
            Motoki,M.T. and Sallum,M.A.
  TITLE     New records of Anopheles homunculus in central and serra do mar
            biodiversity corridors of the Atlantic Forest, Brazil
  JOURNAL   J. Am. Mosq. Control Assoc. 28 (1), 1-5 (2012)
   PUBMED   22533076
REFERENCE   2  (bases 1 to 636)
  AUTHORS   Cardoso,J.C., Bergo,E.S., Oliveira,T.M.P., Sant'Ana,D.C.,
            Motoki,M.T. and Sallum,M.A.M.
  TITLE     Direct Submission
  JOURNAL   Submitted (15-DEC-2011) Epidemiologia, Faculdade de Saude Publica,
            Universidade de Sao Paulo, Avenida Doutor Arnaldo 715, Sao Paulo,
            Sao Paulo 01246904, Brazil
FEATURES             Location/Qualifiers
     source          1..636
                     /organism="Anopheles homunculus"
                     /mol_type="genomic DNA"
                     /country="Brazil: Rio Grande do Sul state, Maquine
                     /collected_by="Sallum MAM and Bergo ES"
                     /PCR_primers="fwd_name: LCO1490, fwd_seq:
                     ggtcaacaaatcataaagatattg, rev_name: HCO2198, rev_seq:
                     /note="larval and pupal exuviae, male genitilia kept as
     gene            <1..>636
     CDS             <1..>636
                     /product="cytochrome c oxidase subunit I"
BASE COUNT          176 a           97 c          103 g          260 t
        1 tgagctggaa tagtcggaac ttctctaaga attttaattc gagctgaatt aggacatcct
       61 ggtgctttta ttggagatga ccaaatttat aatgttattg ttactgctca tgcttttatt
      121 ataatttttt ttatagttat gcctattata attggaggat ttggaaattg attagttcct
      181 ctaatattag gagcacctga tatagctttt cctcgaataa ataatataag attttgaata
      241 ttaccccctt ctttaactct tttagtttca agaagtatag tagaaaatgg ggctggaaca
      301 ggttgaactg tttatcctcc tttatcttct ggaattgctc acgctggagc ttctgtagat
      361 ttagcaattt tttctttaca tttagctggt atttcttcta ttttaggggc agtaaatttt
      421 attactacag ttattaatat acgttctcct ggaattacac tagatcgaat acctttattt
      481 gtatgatcag tagttattac tgcaattcta ttacttttat ctttacctgt tttagcagga
      541 gctattacta tacttttaac tgatcgaaat ttaaatactt cattttttga ccctgcaggt
      601 ggaggagacc caattttata ccaacattta ttttga

LOCUS       JQ291237                 624 bp    DNA     linear   INV 24-APR-2012
DEFINITION  Anopheles homunculus isolate RS20_33 cytochrome c oxidase subunit I
            (COI) gene, partial cds; mitochondrial.
VERSION     JQ291237.1
SOURCE      mitochondrion Anopheles homunculus
  ORGANISM  Anopheles homunculus
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Holometabola; Diptera; Nematocera; Culicoidea;
            Culicidae; Anophelinae; Anopheles.
REFERENCE   1  (bases 1 to 624)
  AUTHORS   da Cardoso,J.C., Bergo,E.S., Oliveira,T.M., Sant'ana,D.C.,
            Motoki,M.T. and Sallum,M.A.
  TITLE     New records of Anopheles homunculus in central and serra do mar
            biodiversity corridors of the Atlantic Forest, Brazil
  JOURNAL   J. Am. Mosq. Control Assoc. 28 (1), 1-5 (2012)
   PUBMED   22533076
REFERENCE   2  (bases 1 to 624)
  AUTHORS   Cardoso,J.C., Bergo,E.S., Oliveira,T.M.P., Sant'Ana,D.C.,
            Motoki,M.T. and Sallum,M.A.M.
  TITLE     Direct Submission
  JOURNAL   Submitted (15-DEC-2011) Epidemiologia, Faculdade de Saude Publica,
            Universidade de Sao Paulo, Avenida Doutor Arnaldo 715, Sao Paulo,
            Sao Paulo 01246904, Brazil
FEATURES             Location/Qualifiers
     source          1..624
                     /organism="Anopheles homunculus"
                     /mol_type="genomic DNA"
                     /country="Brazil: Rio Grande do Sul state, Maquine
                     /collected_by="Sallum MAM and Bergo ES"
                     /PCR_primers="fwd_name: LCO1490, fwd_seq:
                     ggtcaacaaatcataaagatattg, rev_name: HCO2198, rev_seq:
                     /note="larval and pupal exuviae, male genitilia kept as
     gene            <1..>624
     CDS             <1..>624
                     /product="cytochrome c oxidase subunit I"
BASE COUNT          172 a           96 c          101 g          255 t
        1 catgagctgg aatagttgga acttctctaa gaattttaat tcgagctgaa ttaggtcatc
       61 ctggtgcttt tattggagat gaccaaattt ataatgttat tgttactgct catgctttta
      121 ttataatttt ttttatagtt atgcctatta taattggagg atttggaaat tgattagttc
      181 ctctaatatt aggagcacct gatatagctt ttcctcgaat aaataatata agattttgaa
      241 tattaccccc ttctttaact cttttagttt caagaagtat agtagaaaat ggggctggaa
      301 caggttgaac tgtttatcct cctttatctt ctggaattgc tcacgctgga gcttctgtag
      361 atttagcaat tttttcttta catttagctg gtatttcttc tattttagga gcagtaaatt
      421 ttattactac agttattaat atacgttctc ctggaattac actagatcga atacctttat
      481 ttgtatgatc agtagttatt actgcaattc tattactttt atctttacct gttttagcag
      541 gagctattac tatactttta actgatcgaa atttaaatac ttcatttttt gaccctgcag
      601 gtggaggaga cccaatttta tacc

LOCUS       JQ291238                 644 bp    DNA     linear   INV 24-APR-2012
DEFINITION  Anopheles homunculus isolate RS30_56 cytochrome c oxidase subunit I
            (COI) gene, partial cds; mitochondrial.
VERSION     JQ291238.1
SOURCE      mitochondrion Anopheles homunculus
  ORGANISM  Anopheles homunculus
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Holometabola; Diptera; Nematocera; Culicoidea;
            Culicidae; Anophelinae; Anopheles.
REFERENCE   1  (bases 1 to 644)
  AUTHORS   da Cardoso,J.C., Bergo,E.S., Oliveira,T.M., Sant'ana,D.C.,
            Motoki,M.T. and Sallum,M.A.
  TITLE     New records of Anopheles homunculus in central and serra do mar
            biodiversity corridors of the Atlantic Forest, Brazil
  JOURNAL   J. Am. Mosq. Control Assoc. 28 (1), 1-5 (2012)
   PUBMED   22533076
REFERENCE   2  (bases 1 to 644)
  AUTHORS   Cardoso,J.C., Bergo,E.S., Oliveira,T.M.P., Sant'Ana,D.C.,
            Motoki,M.T. and Sallum,M.A.M.
  TITLE     Direct Submission
  JOURNAL   Submitted (15-DEC-2011) Epidemiologia, Faculdade de Saude Publica,
            Universidade de Sao Paulo, Avenida Doutor Arnaldo 715, Sao Paulo,
            Sao Paulo 01246904, Brazil
FEATURES             Location/Qualifiers
     source          1..644
                     /organism="Anopheles homunculus"
                     /mol_type="genomic DNA"
                     /country="Brazil: Rio Grande do Sul state, Maquine
                     /collected_by="Sallum MAM and Bergo ES"
                     /PCR_primers="fwd_name: LCO1490, fwd_seq:
                     ggtcaacaaatcataaagatattg, rev_name: HCO2198, rev_seq:
                     /note="larval and pupal exuviae, male genitilia kept as
     gene            <1..>644
     CDS             <1..>644
                     /product="cytochrome c oxidase subunit I"
BASE COUNT          174 a           97 c          109 g          264 t
        1 gatattggta ctttatattt tatttttggg gcatgagctg gaatagtcgg aacttctcta
       61 agaattttaa ttcgagctga attaggacat cctggtgctt ttattggaga tgaccaaatt
      121 tataatgtta ttgttactgc tcatgctttt attataattt tttttatagt tatgcctatt
      181 ataattggag gattcggaaa ttgattagtt cctctaatat taggagcacc tgatatagct
      241 tttcctcgaa taaataatat aagattttga atattacccc cttctttaac tcttttagtt
      301 tcaagaagta tagtagaaaa tggggctgga acaggttgaa ctgtttatcc tcctttatct
      361 tctggaattg ctcacgctgg agcttctgta gatttagcaa ttttttcttt acatttagct
      421 ggtatttctt ctattttagg ggcagtaaat tttattacta cagttattaa tatacgttct
      481 cctggaatta cactagatcg aataccttta tttgtatgat cagtagttat tactgcaatt
      541 ctattacttt tatctttacc tgttttagca ggagctatta ctatactttt aactgatcga
      601 aatttaaata cttcattttt tgaccctgca ggtggaggag accc

LOCUS       JQ291239                 668 bp    DNA     linear   INV 24-APR-2012
DEFINITION  Anopheles homunculus isolate RS30_158 cytochrome c oxidase subunit
            I (COI) gene, partial cds; mitochondrial.
VERSION     JQ291239.1
SOURCE      mitochondrion Anopheles homunculus
  ORGANISM  Anopheles homunculus
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Holometabola; Diptera; Nematocera; Culicoidea;
            Culicidae; Anophelinae; Anopheles.
REFERENCE   1  (bases 1 to 668)
  AUTHORS   da Cardoso,J.C., Bergo,E.S., Oliveira,T.M., Sant'ana,D.C.,
            Motoki,M.T. and Sallum,M.A.
  TITLE     New records of Anopheles homunculus in central and serra do mar
            biodiversity corridors of the Atlantic Forest, Brazil
  JOURNAL   J. Am. Mosq. Control Assoc. 28 (1), 1-5 (2012)
   PUBMED   22533076
REFERENCE   2  (bases 1 to 668)
  AUTHORS   Cardoso,J.C., Bergo,E.S., Oliveira,T.M.P., Sant'Ana,D.C.,
            Motoki,M.T. and Sallum,M.A.M.
  TITLE     Direct Submission
  JOURNAL   Submitted (15-DEC-2011) Epidemiologia, Faculdade de Saude Publica,
            Universidade de Sao Paulo, Avenida Doutor Arnaldo 715, Sao Paulo,
            Sao Paulo 01246904, Brazil
FEATURES             Location/Qualifiers
     source          1..668
                     /organism="Anopheles homunculus"
                     /mol_type="genomic DNA"
                     /country="Brazil: Rio Grande do Sul state, Maquine
                     /collected_by="Sallum MAM and Bergo ES"
                     /PCR_primers="fwd_name: LCO1490, fwd_seq:
                     ggtcaacaaatcataaagatattg, rev_name: HCO2198, rev_seq:
                     /note="larval and pupal exuviae, male genitilia kept as
     gene            <1..>668
     CDS             <1..>668
                     /product="cytochrome c oxidase subunit I"
BASE COUNT          183 a          100 c          108 g          277 t
        1 atattggtac tttatatttt atttttgggg catgagctgg aatagtcgga acttctctaa
       61 gaattttaat tcgagctgaa ttaggtcatc ctggtgcttt tattggagat gaccaaattt
      121 ataatgttat tgttactgct catgctttta ttataatttt ttttatagtt atgcctatta
      181 taattggagg attcggaaat tgattagttc ctctaatatt aggagcacct gatatagctt
      241 ttcctcgaat aaataatata agattttgaa tattaccccc ttctttaact cttttagttt
      301 caagaagtat agtagaaaat ggggctggaa caggttgaac tgtttatcct cctttatctt
      361 ctggaattgc tcacgctgga gcttctgtag atttagcaat tttttcttta catttagctg
      421 gtatttcttc tattttagga gcagtaaatt ttattactac agttattaat atacgttctc
      481 ctggaattac actagatcga atacctttat ttgtatgatc agtagttatt actgcaattc
      541 tattactttt atctttacct gttttagcag gagctattac tatactttta actgatcgaa
      601 atttaaatac ttcatttttt gaccctgcag gtggaggaga cccaatttta taccaacatt
      661 tattttga

LOCUS       JQ291240                 656 bp    DNA     linear   INV 24-APR-2012
DEFINITION  Anopheles homunculus isolate SP23_1 cytochrome c oxidase subunit I
            (COI) gene, partial cds; mitochondrial.
VERSION     JQ291240.1
SOURCE      mitochondrion Anopheles homunculus
  ORGANISM  Anopheles homunculus
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Holometabola; Diptera; Nematocera; Culicoidea;
            Culicidae; Anophelinae; Anopheles.
REFERENCE   1  (bases 1 to 656)
  AUTHORS   da Cardoso,J.C., Bergo,E.S., Oliveira,T.M., Sant'ana,D.C.,
            Motoki,M.T. and Sallum,M.A.
  TITLE     New records of Anopheles homunculus in central and serra do mar
            biodiversity corridors of the Atlantic Forest, Brazil
  JOURNAL   J. Am. Mosq. Control Assoc. 28 (1), 1-5 (2012)
   PUBMED   22533076
REFERENCE   2  (bases 1 to 656)
  AUTHORS   Cardoso,J.C., Bergo,E.S., Oliveira,T.M.P., Sant'Ana,D.C.,
            Motoki,M.T. and Sallum,M.A.M.
  TITLE     Direct Submission
  JOURNAL   Submitted (15-DEC-2011) Epidemiologia, Faculdade de Saude Publica,
            Universidade de Sao Paulo, Avenida Doutor Arnaldo 715, Sao Paulo,
            Sao Paulo 01246904, Brazil
FEATURES             Location/Qualifiers
     source          1..656
                     /organism="Anopheles homunculus"
                     /mol_type="genomic DNA"
                     /country="Brazil: Sao Paulo state, Cananeia municipality"
                     /collected_by="Sallum MAM"
                     /PCR_primers="fwd_name: LCO1490, fwd_seq:
                     ggtcaacaaatcataaagatattg, rev_name: HCO2198, rev_seq:
                     /note="larval and pupal exuviae, male genitilia kept as
     gene            <1..>656
     CDS             <1..>656
                     /product="cytochrome c oxidase subunit I"
BASE COUNT          179 a           99 c          109 g          269 t
        1 gatattggta ctttatattt tatttttggg gcatgagctg gaatagtcgg aacttctcta
       61 agaattttaa ttcgagctga attaggacat cctggtgctt ttattggaga tgatcaaatt
      121 tataatgtta ttgttactgc tcatgctttt attataattt tttttatagt tatgcctatt
      181 ataattggag gattcggaaa ttgattagtt cctctaatat taggagcacc tgatatagct
      241 tttcctcgaa taaataatat aagattttga atattacccc cttctttaac tcttttagtt
      301 tcaagaagta tagtagaaaa tggggctgga acaggttgaa ctgtttatcc tcctttatct
      361 tccggaattg ctcacgctgg agcttctgta gatttagcaa ttttttcttt acatttagct
      421 ggtatttctt ctattttagg ggcagtaaat tttattacta cagttattaa tatacgttct
      481 cctggaatta cactagatcg aataccttta tttgtatgat cagtagttat tactgcaatt
      541 ctattacttt tatctttacc tgttttagca ggagctatta ctatactttt aactgatcga
      601 aatttaaata cttcattttt tgaccctgca ggtggaggag acccaatttt atacca

LOCUS       JQ291241                 661 bp    DNA     linear   INV 24-APR-2012
DEFINITION  Anopheles homunculus isolate ST19 cytochrome c oxidase subunit I
            (COI) gene, partial cds; mitochondrial.
VERSION     JQ291241.1
SOURCE      mitochondrion Anopheles homunculus
  ORGANISM  Anopheles homunculus
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Holometabola; Diptera; Nematocera; Culicoidea;
            Culicidae; Anophelinae; Anopheles.
REFERENCE   1  (bases 1 to 661)
  AUTHORS   da Cardoso,J.C., Bergo,E.S., Oliveira,T.M., Sant'ana,D.C.,
            Motoki,M.T. and Sallum,M.A.
  TITLE     New records of Anopheles homunculus in central and serra do mar
            biodiversity corridors of the Atlantic Forest, Brazil
  JOURNAL   J. Am. Mosq. Control Assoc. 28 (1), 1-5 (2012)
   PUBMED   22533076
REFERENCE   2  (bases 1 to 661)
  AUTHORS   Cardoso,J.C., Bergo,E.S., Oliveira,T.M.P., Sant'Ana,D.C.,
            Motoki,M.T. and Sallum,M.A.M.
  TITLE     Direct Submission
  JOURNAL   Submitted (15-DEC-2011) Epidemiologia, Faculdade de Saude Publica,
            Universidade de Sao Paulo, Avenida Doutor Arnaldo 715, Sao Paulo,
            Sao Paulo 01246904, Brazil
FEATURES             Location/Qualifiers
     source          1..661
                     /organism="Anopheles homunculus"
                     /mol_type="genomic DNA"
                     /country="Brazil: Sao Paulo state, Cananeia municipality"
                     /collected_by="Sallum MAM"
                     /PCR_primers="fwd_name: LCO1490, fwd_seq:
                     ggtcaacaaatcataaagatattg, rev_name: HCO2198, rev_seq:
                     /note="larval and pupal exuviae, male genitilia kept as
     gene            <1..>661
     CDS             <1..>661
                     /product="cytochrome c oxidase subunit I"
BASE COUNT          183 a           99 c          107 g          272 t
        1 tactttatat tttatttttg gggcatgagc tggaatagtc ggaacttctc taagaatttt
       61 aattcgagct gaattaggac atcctggtgc ttttattgga gatgaccaaa tttataatgt
      121 tattgttact gctcatgctt ttattataat tttttttata gttatgccta ttataattgg
      181 aggattcgga aattgattag ttcctctaat attaggagca cctgatatag cttttcctcg
      241 aataaataat ataagatttt gaatattacc gccttcttta actcttttag tttcaagaag
      301 tatagtagaa aatggggctg gaacaggttg aactgtttat cctcctttat cttctggaat
      361 tgctcacgct ggagcttctg tagatttagc aattttttca ttacatttag ctggtatttc
      421 ttctatttta ggagcagtaa attttattac tacagttatt aatatacgtt ctcctggaat
      481 tacactagat cgaatacctt tatttgtatg atcagtagtt attactgcaa ttctattact
      541 tttatcttta cctgttttag caggagctat tactatactt ttaactgatc gaaatttaaa
      601 tacttcattt tttgaccctg caggtggagg agacccaatt ttataccaac atttattttg
      661 a

LOCUS       JQ291242                 667 bp    DNA     linear   INV 24-APR-2012
DEFINITION  Anopheles homunculus isolate ST26 cytochrome c oxidase subunit I
            (COI) gene, partial cds; mitochondrial.
VERSION     JQ291242.1
SOURCE      mitochondrion Anopheles homunculus
  ORGANISM  Anopheles homunculus
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Holometabola; Diptera; Nematocera; Culicoidea;
            Culicidae; Anophelinae; Anopheles.
REFERENCE   1  (bases 1 to 667)
  AUTHORS   da Cardoso,J.C., Bergo,E.S., Oliveira,T.M., Sant'ana,D.C.,
            Motoki,M.T. and Sallum,M.A.
  TITLE     New records of Anopheles homunculus in central and serra do mar
            biodiversity corridors of the Atlantic Forest, Brazil
  JOURNAL   J. Am. Mosq. Control Assoc. 28 (1), 1-5 (2012)
   PUBMED   22533076
REFERENCE   2  (bases 1 to 667)
  AUTHORS   Cardoso,J.C., Bergo,E.S., Oliveira,T.M.P., Sant'Ana,D.C.,
            Motoki,M.T. and Sallum,M.A.M.
  TITLE     Direct Submission
  JOURNAL   Submitted (15-DEC-2011) Epidemiologia, Faculdade de Saude Publica,
            Universidade de Sao Paulo, Avenida Doutor Arnaldo 715, Sao Paulo,
            Sao Paulo 01246904, Brazil
FEATURES             Location/Qualifiers
     source          1..667
                     /organism="Anopheles homunculus"
                     /mol_type="genomic DNA"
                     /country="Brazil: Sao Paulo state, Cananeia municipality"
                     /collected_by="Sallum MAM"
                     /PCR_primers="fwd_name: LCO1490, fwd_seq:
                     ggtcaacaaatcataaagatattg, rev_name: HCO2198, rev_seq:
                     /note="larval and pupal exuviae, male genitilia kept as
     gene            <1..>667
     CDS             <1..>667
                     /product="cytochrome c oxidase subunit I"
BASE COUNT          183 a          100 c          108 g          276 t
        1 gatattggta ctttatattt tatttttggg gcatgagctg gaatagtcgg aacttctcta
       61 agaattttaa ttcgagctga attaggacat cctggtgctt ttattggaga tgaccaaatt
      121 tataatgtta ttgttactgc tcatgctttt attataattt tttttatagt tatacctatt
      181 ataattggag gattcggaaa ttgattagtt cctctaatat taggagcacc tgatatagct
      241 tttcctcgaa taaataatat aagattttga atattacccc cttctttaac tcttttagtt
      301 tcaagaagta tagtagaaaa tggggctgga acaggttgaa ctgtttatcc tcctttatct
      361 tctggaattg ctcacgctgg agcttctgta gatttagcaa ttttttcttt acatttagct
      421 ggtatttctt ctattttagg ggcagtaaat tttattacta cagttattaa tatacgttct
      481 cctggaatta cactagatcg aataccttta tttgtatgat cagtagttat tactgcaatt
      541 ctattacttt tatctttacc tgttttagca ggagctatta ctatactttt aactgatcga
      601 aatttaaata cttcattttt tgaccctgca ggtggaggag acccaatttt ataccaacat
      661 ttatttt

LOCUS       JQ291243                 479 bp    DNA     linear   INV 24-APR-2012
DEFINITION  Anopheles homunculus isolate BA22_31 5.8S ribosomal RNA gene,
            partial sequence; internal transcribed spacer 2, complete sequence;
            and 28S ribosomal RNA gene, partial sequence.
VERSION     JQ291243.1
SOURCE      Anopheles homunculus
  ORGANISM  Anopheles homunculus
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Holometabola; Diptera; Nematocera; Culicoidea;
            Culicidae; Anophelinae; Anopheles.
REFERENCE   1  (bases 1 to 479)
  AUTHORS   da Cardoso,J.C., Bergo,E.S., Oliveira,T.M., Sant'ana,D.C.,
            Motoki,M.T. and Sallum,M.A.
  TITLE     New records of Anopheles homunculus in central and Serra do Mar
            biodiversity corridors of the Atlantic Forest, Brazil
  JOURNAL   J. Am. Mosq. Control Assoc. 28 (1), 1-5 (2012)
   PUBMED   22533076
REFERENCE   2  (bases 1 to 479)
  AUTHORS   Cardoso,J.C., Bergo,E.S., Oliveira,T.M.P., Sant'Ana,D.C.,
            Motoki,M.T. and Sallum,M.A.M.
  TITLE     Direct Submission
  JOURNAL   Submitted (15-DEC-2011) Epidemiologia, Faculdade de Saude Publica,
            Universidade de Sao Paulo, Avenida Doutor Arnaldo 715, Sao Paulo,
            Sao Paulo 01246904, Brazil
FEATURES             Location/Qualifiers
     source          1..479
                     /organism="Anopheles homunculus"
                     /mol_type="genomic DNA"
                     /country="Brazil: Bahia state, Camacan municipality,
                     Reserva Serra Bonita"
                     /collected_by="Sallum MAM, Bergo ES"
                     /PCR_primers="fwd_name: 5.8SF, fwd_seq:
                     atcactcggctcgtggatcg, rev_name: 28SR, rev_seq:
                     /note="larval and pupal exuviae, male genitilia kept as
     rRNA            <1..124
                     /product="5.8S ribosomal RNA"
     misc_RNA        125..470
                     /product="internal transcribed spacer 2"
     rRNA            471..>479
                     /product="28S ribosomal RNA"
BASE COUNT          112 a          141 c          136 g           90 t
        1 atgaagaccg cagctaaatg cgcgtcagaa tgtgaactgc aggacacatg aacaccgata
       61 cgttgaacgc atattgcaca tcgcacgaca cagtgcgatg tacacatttt tgagtgccca
      121 tcctcaccgc atagccaact atcgggcccg caagggctcc gatgcataat gatgcgttgc
      181 ccagcctcgc ggctggtcaa tcattgaaac tgtgtgcgta ggaggggccg accggagcgt
      241 gcgcgcgagg tccgctttcg cgagcgtctt ccgtcacggc tgagccacct tacgactctc
      301 accaggaaaa acccccatgg tgcagatata caattcgaac gaccccacgc gttcggtggc
      361 ctcagtgcgg tgacgataga gcgggaagac gccagagtat cgcttgagag cgggtccgtc
      421 gcgcgcgcgt cgacggcgcg gtcccacaca catcctatag tgggcctcaa ataatgtgt

LOCUS       JQ291244                 479 bp    DNA     linear   INV 24-APR-2012
DEFINITION  Anopheles homunculus isolate BA22_33 5.8S ribosomal RNA gene,
            partial sequence; internal transcribed spacer 2, complete sequence;
            and 28S ribosomal RNA gene, partial sequence.
VERSION     JQ291244.1
SOURCE      Anopheles homunculus
  ORGANISM  Anopheles homunculus
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Holometabola; Diptera; Nematocera; Culicoidea;
            Culicidae; Anophelinae; Anopheles.
REFERENCE   1  (bases 1 to 479)
  AUTHORS   da Cardoso,J.C., Bergo,E.S., Oliveira,T.M., Sant'ana,D.C.,
            Motoki,M.T. and Sallum,M.A.
  TITLE     New records of Anopheles homunculus in central and Serra do Mar
            biodiversity corridors of the Atlantic Forest, Brazil
  JOURNAL   J. Am. Mosq. Control Assoc. 28 (1), 1-5 (2012)
   PUBMED   22533076
REFERENCE   2  (bases 1 to 479)
  AUTHORS   Cardoso,J.C., Bergo,E.S., Oliveira,T.M.P., Sant'Ana,D.C.,
            Motoki,M.T. and Sallum,M.A.M.
  TITLE     Direct Submission
  JOURNAL   Submitted (15-DEC-2011) Epidemiologia, Faculdade de Saude Publica,
            Universidade de Sao Paulo, Avenida Doutor Arnaldo 715, Sao Paulo,
            Sao Paulo 01246904, Brazil
FEATURES             Location/Qualifiers
     source          1..479
                     /organism="Anopheles homunculus"
                     /mol_type="genomic DNA"
                     /country="Brazil: Bahia state, Camacan municipality,
                     Reserva Serra Bonita"
                     /collected_by="Sallum MAM, Bergo ES"
                     /PCR_primers="fwd_name: 5.8SF, fwd_seq:
                     atcactcggctcgtggatcg, rev_name: 28SR, rev_seq:
                     /note="larval and pupal exuviae kept as vouchers"
     rRNA            <1..124
                     /product="5.8S ribosomal RNA"
     misc_RNA        125..470
                     /product="internal transcribed spacer 2"
     rRNA            471..>479
                     /product="28S ribosomal RNA"
BASE COUNT          112 a          141 c          136 g           90 t
        1 atgaagaccg cagctaaatg cgcgtcagaa tgtgaactgc aggacacatg aacaccgata
       61 cgttgaacgc atattgcaca tcgcacgaca cagtgcgatg tacacatttt tgagtgccca
      121 tcctcaccgc atagccaact atcgggcccg caagggctcc gatgcataat gatgcgttgc
      181 ccagcctcgc ggctggtcaa tcattgaaac tgtgtgcgta ggaggggccg accggagcgt
      241 gcgcgcgagg tccgctttcg cgagcgtctt ccgtcacggc tgagccacct tacgactctc
      301 accaggaaaa acccccatgg tgcagatata caattcgaac gaccccacgc gttcggtggc
      361 ctcagtgcgg tgacgataga gcgggaagac gccagagtat cgcttgagag cgggtccgtc
      421 gcgcgcgcgt cgacggcgcg gtcccacaca catcctatag tgggcctcaa ataatgtgt

LOCUS       JQ291245                 479 bp    DNA     linear   INV 24-APR-2012
DEFINITION  Anopheles homunculus isolate RS20_21 5.8S ribosomal RNA gene,
            partial sequence; internal transcribed spacer 2, complete sequence;
            and 28S ribosomal RNA gene, partial sequence.
VERSION     JQ291245.1
SOURCE      Anopheles homunculus
  ORGANISM  Anopheles homunculus
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Holometabola; Diptera; Nematocera; Culicoidea;
            Culicidae; Anophelinae; Anopheles.
REFERENCE   1  (bases 1 to 479)
  AUTHORS   da Cardoso,J.C., Bergo,E.S., Oliveira,T.M., Sant'ana,D.C.,
            Motoki,M.T. and Sallum,M.A.
  TITLE     New records of Anopheles homunculus in central and Serra do Mar
            biodiversity corridors of the Atlantic Forest, Brazil
  JOURNAL   J. Am. Mosq. Control Assoc. 28 (1), 1-5 (2012)
   PUBMED   22533076
REFERENCE   2  (bases 1 to 479)
  AUTHORS   Cardoso,J.C., Bergo,E.S., Oliveira,T.M.P., Sant'Ana,D.C.,
            Motoki,M.T. and Sallum,M.A.M.
  TITLE     Direct Submission
  JOURNAL   Submitted (15-DEC-2011) Epidemiologia, Faculdade de Saude Publica,
            Universidade de Sao Paulo, Avenida Doutor Arnaldo 715, Sao Paulo,
            Sao Paulo 01246904, Brazil
FEATURES             Location/Qualifiers
     source          1..479
                     /organism="Anopheles homunculus"
                     /mol_type="genomic DNA"
                     /country="Brazil: Rio Grande do Sul state, Maquine"
                     /collected_by="Sallum MAM, Bergo ES"
                     /PCR_primers="fwd_name: 5.8SF, fwd_seq:
                     atcactcggctcgtggatcg, rev_name: 28SR, rev_seq:
                     /note="larval and pupal exuviae, male genitilia kept as
     rRNA            <1..124
                     /product="5.8S ribosomal RNA"
     misc_RNA        125..470
                     /product="internal transcribed spacer 2"
     rRNA            471..>479
                     /product="28S ribosomal RNA"
BASE COUNT          112 a          141 c          136 g           90 t
        1 atgaagaccg cagctaaatg cgcgtcagaa tgtgaactgc aggacacatg aacaccgata
       61 cgttgaacgc atattgcaca tcgcacgaca cagtgcgatg tacacatttt tgagtgccca
      121 tcctcaccgc atagccaact atcgggcccg caagggctcc gatgcataat gatgcgttgc
      181 ccagcctcgc ggctggtcaa tcattgaaac tgtgtgcgta ggaggggccg accggagcgt
      241 gcgcgcgagg tccgctttcg cgagcgtctt ccgtcacggc tgagccacct tacgactctc
      301 accaggaaaa acccccatgg tgcagatata caattcgaac gaccccacgc gttcggtggc
      361 ctcagtgcgg tgacgataga gcgggaagac gccagagtat cgcttgagag cgggtccgtc
      421 gcgcgcgcgt cgacggcgcg gtcccacaca catcctatag tgggcctcaa ataatgtgt

LOCUS       JQ291246                 479 bp    DNA     linear   INV 24-APR-2012
DEFINITION  Anopheles homunculus isolate RS20_33 5.8S ribosomal RNA gene,
            partial sequence; internal transcribed spacer 2, complete sequence;
            and 28S ribosomal RNA gene, partial sequence.
VERSION     JQ291246.1
SOURCE      Anopheles homunculus
  ORGANISM  Anopheles homunculus
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Holometabola; Diptera; Nematocera; Culicoidea;
            Culicidae; Anophelinae; Anopheles.
REFERENCE   1  (bases 1 to 479)
  AUTHORS   da Cardoso,J.C., Bergo,E.S., Oliveira,T.M., Sant'ana,D.C.,
            Motoki,M.T. and Sallum,M.A.
  TITLE     New records of Anopheles homunculus in central and Serra do Mar
            biodiversity corridors of the Atlantic Forest, Brazil
  JOURNAL   J. Am. Mosq. Control Assoc. 28 (1), 1-5 (2012)
   PUBMED   22533076
REFERENCE   2  (bases 1 to 479)
  AUTHORS   Cardoso,J.C., Bergo,E.S., Oliveira,T.M.P., Sant'Ana,D.C.,
            Motoki,M.T. and Sallum,M.A.M.
  TITLE     Direct Submission
  JOURNAL   Submitted (15-DEC-2011) Epidemiologia, Faculdade de Saude Publica,
            Universidade de Sao Paulo, Avenida Doutor Arnaldo 715, Sao Paulo,
            Sao Paulo 01246904, Brazil
FEATURES             Location/Qualifiers
     source          1..479
                     /organism="Anopheles homunculus"
                     /mol_type="genomic DNA"
                     /country="Brazil: Rio Grande do Sul state, Maquine"
                     /collected_by="Sallum MAM, Bergo ES"
                     /PCR_primers="fwd_name: 5.8SF, fwd_seq:
                     atcactcggctcgtggatcg, rev_name: 28SR, rev_seq:
                     /note="larval and pupal exuviae, male genitilia kept as
     rRNA            <1..124
                     /product="5.8S ribosomal RNA"
     misc_RNA        125..470
                     /product="internal transcribed spacer 2"
     rRNA            471..>479
                     /product="28S ribosomal RNA"
BASE COUNT          112 a          141 c          136 g           90 t
        1 atgaagaccg cagctaaatg cgcgtcagaa tgtgaactgc aggacacatg aacaccgata
       61 cgttgaacgc atattgcaca tcgcacgaca cagtgcgatg tacacatttt tgagtgccca
      121 tcctcaccgc atagccaact atcgggcccg caagggctcc gatgcataat gatgcgttgc
      181 ccagcctcgc ggctggtcaa tcattgaaac tgtgtgcgta ggaggggccg accggagcgt
      241 gcgcgcgagg tccgctttcg cgagcgtctt ccgtcacggc tgagccacct tacgactctc
      301 accaggaaaa acccccatgg tgcagatata caattcgaac gaccccacgc gttcggtggc
      361 ctcagtgcgg tgacgataga gcgggaagac gccagagtat cgcttgagag cgggtccgtc
      421 gcgcgcgcgt cgacggcgcg gtcccacaca catcctatag tgggcctcaa ataatgtgt

LOCUS       JQ291247                 479 bp    DNA     linear   INV 24-APR-2012
DEFINITION  Anopheles homunculus isolate RS30_56 5.8S ribosomal RNA gene,
            partial sequence; internal transcribed spacer 2, complete sequence;
            and 28S ribosomal RNA gene, partial sequence.
VERSION     JQ291247.1
SOURCE      Anopheles homunculus
  ORGANISM  Anopheles homunculus
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Holometabola; Diptera; Nematocera; Culicoidea;
            Culicidae; Anophelinae; Anopheles.
REFERENCE   1  (bases 1 to 479)
  AUTHORS   da Cardoso,J.C., Bergo,E.S., Oliveira,T.M., Sant'ana,D.C.,
            Motoki,M.T. and Sallum,M.A.
  TITLE     New records of Anopheles homunculus in central and Serra do Mar
            biodiversity corridors of the Atlantic Forest, Brazil
  JOURNAL   J. Am. Mosq. Control Assoc. 28 (1), 1-5 (2012)
   PUBMED   22533076
REFERENCE   2  (bases 1 to 479)
  AUTHORS   Cardoso,J.C., Bergo,E.S., Oliveira,T.M.P., Sant'Ana,D.C.,
            Motoki,M.T. and Sallum,M.A.M.
  TITLE     Direct Submission
  JOURNAL   Submitted (15-DEC-2011) Epidemiologia, Faculdade de Saude Publica,
            Universidade de Sao Paulo, Avenida Doutor Arnaldo 715, Sao Paulo,
            Sao Paulo 01246904, Brazil
FEATURES             Location/Qualifiers
     source          1..479
                     /organism="Anopheles homunculus"
                     /mol_type="genomic DNA"
                     /country="Brazil: Rio Grande do Sul state, Maquine"
                     /collected_by="Sallum MAM, Bergo ES"
                     /PCR_primers="fwd_name: 5.8SF, fwd_seq:
                     atcactcggctcgtggatcg, rev_name: 28SR, rev_seq:
                     /note="larval and pupal exuviae, male genitilia kept as
     rRNA            <1..124
                     /product="5.8S ribosomal RNA"
     misc_RNA        125..470
                     /product="internal transcribed spacer 2"
     rRNA            471..>479
                     /product="28S ribosomal RNA"
BASE COUNT          112 a          141 c          136 g           90 t
        1 atgaagaccg cagctaaatg cgcgtcagaa tgtgaactgc aggacacatg aacaccgata
       61 cgttgaacgc atattgcaca tcgcacgaca cagtgcgatg tacacatttt tgagtgccca
      121 tcctcaccgc atagccaact atcgggcccg caagggctcc gatgcataat gatgcgttgc
      181 ccagcctcgc ggctggtcaa tcattgaaac tgtgtgcgta ggaggggccg accggagcgt
      241 gcgcgcgagg tccgctttcg cgagcgtctt ccgtcacggc tgagccacct tacgactctc
      301 accaggaaaa acccccatgg tgcagatata caattcgaac gaccccacgc gttcggtggc
      361 ctcagtgcgg tgacgataga gcgggaagac gccagagtat cgcttgagag cgggtccgtc
      421 gcgcgcgcgt cgacggcgcg gtcccacaca catcctatag tgggcctcaa ataatgtgt

LOCUS       JQ291248                 479 bp    DNA     linear   INV 24-APR-2012
DEFINITION  Anopheles homunculus isolate RS30_158 5.8S ribosomal RNA gene,
            partial sequence; internal transcribed spacer 2, complete sequence;
            and 28S ribosomal RNA gene, partial sequence.
VERSION     JQ291248.1
SOURCE      Anopheles homunculus
  ORGANISM  Anopheles homunculus
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Holometabola; Diptera; Nematocera; Culicoidea;
            Culicidae; Anophelinae; Anopheles.
REFERENCE   1  (bases 1 to 479)
  AUTHORS   da Cardoso,J.C., Bergo,E.S., Oliveira,T.M., Sant'ana,D.C.,
            Motoki,M.T. and Sallum,M.A.
  TITLE     New records of Anopheles homunculus in central and Serra do Mar
            biodiversity corridors of the Atlantic Forest, Brazil
  JOURNAL   J. Am. Mosq. Control Assoc. 28 (1), 1-5 (2012)
   PUBMED   22533076
REFERENCE   2  (bases 1 to 479)
  AUTHORS   Cardoso,J.C., Bergo,E.S., Oliveira,T.M.P., Sant'Ana,D.C.,
            Motoki,M.T. and Sallum,M.A.M.
  TITLE     Direct Submission
  JOURNAL   Submitted (15-DEC-2011) Epidemiologia, Faculdade de Saude Publica,
            Universidade de Sao Paulo, Avenida Doutor Arnaldo 715, Sao Paulo,
            Sao Paulo 01246904, Brazil
FEATURES             Location/Qualifiers
     source          1..479
                     /organism="Anopheles homunculus"
                     /mol_type="genomic DNA"
                     /country="Brazil: Rio Grande do Sul state, Maquine"
                     /collected_by="Sallum MAM, Bergo ES"
                     /PCR_primers="fwd_name: 5.8SF, fwd_seq:
                     atcactcggctcgtggatcg, rev_name: 28SR, rev_seq:
                     /note="larval and pupal exuviae, male genitilia kept as
     rRNA            <1..124
                     /product="5.8S ribosomal RNA"
     misc_RNA        125..470
                     /product="internal transcribed spacer 2"
     rRNA            471..>479
                     /product="28S ribosomal RNA"
BASE COUNT          112 a          141 c          136 g           90 t
        1 atgaagaccg cagctaaatg cgcgtcagaa tgtgaactgc aggacacatg aacaccgata
       61 cgttgaacgc atattgcaca tcgcacgaca cagtgcgatg tacacatttt tgagtgccca
      121 tcctcaccgc atagccaact atcgggcccg caagggctcc gatgcataat gatgcgttgc
      181 ccagcctcgc ggctggtcaa tcattgaaac tgtgtgcgta ggaggggccg accggagcgt
      241 gcgcgcgagg tccgctttcg cgagcgtctt ccgtcacggc tgagccacct tacgactctc
      301 accaggaaaa acccccatgg tgcagatata caattcgaac gaccccacgc gttcggtggc
      361 ctcagtgcgg tgacgataga gcgggaagac gccagagtat cgcttgagag cgggtccgtc
      421 gcgcgcgcgt cgacggcgcg gtcccacaca catcctatag tgggcctcaa ataatgtgt