LOCUS       GR367900                 430 bp    mRNA    linear   EST 17-APR-2013
DEFINITION  Fp_fpk1_24F11_T7 Fomitopsis palustris cDNA library FP1 Fomitopsis
            palustris cDNA clone Fp_fpk1_24F11 5', mRNA sequence.
ACCESSION   GR367900
VERSION     GR367900.1
DBLINK      BioSample: SAMN00167773
KEYWORDS    EST.
SOURCE      Fomitopsis palustris
  ORGANISM  Fomitopsis palustris
            Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina;
            Agaricomycetes; Polyporales; Fomitopsis.
REFERENCE   1  (bases 1 to 430)
  AUTHORS   Karim,N., Shibuya,H. and Kikuchi,T.
  TITLE     Analysis of expressed sequence tags from wood-decaying fungus
            Fomitopsis palustris and identification of potential genes involved
            in the decay process
  JOURNAL   J. Microbiol. Biotechnol. 21 (4), 347-358 (2011)
   PUBMED   21532317
COMMENT     Contact: Taisei Kikuchi
            Forestry and Forest Products Research Institute
            1, matunosato, Tsukuba, Ibaraki 305-8687, Japan
            Email: kikuchit@affrc.go.jp
            Plate: 24  row: F  column: 11
            Seq primer: T7(GTAATACGACTCACTATAGGGC)
            High quality sequence stop: 429.
FEATURES             Location/Qualifiers
     source          1..430
                     /organism="Fomitopsis palustris"
                     /mol_type="mRNA"
                     /strain="NBRC 30339"
                     /db_xref="taxon:2870670"
                     /clone="Fp_fpk1_24F11"
                     /clone_lib="SAMN00167773 Fomitopsis palustris cDNA library
                     FP1"
                     /note="Vector: pSPORTI; Site_1: NotI; Site_2: SalI"
BASE COUNT           89 a          140 c          116 g           85 t
ORIGIN      
        1 gaagcagaaa cacattcatt cgcgacattc gttgacttcg ctctacaccc actcgtatac
       61 cctttttctt ctctcttcac gactctaacg aacgagatgg cgctttccac tttcttcaac
      121 gagccgttct actccctcgc cgactttgac cgcctcttcg acgaggcgtt ctctgcgcgc
      181 actggtgccg gtgccaacgg ccgccagctg cagcagcagg atgggtctcc acgtgcgctc
      241 cgtccaagga tggatctgca tgaggacgcc cagcagaacc tcgtgacggc gacgttcgag
      301 ctgcccggtc tcaacaagga gaacgtgagc aatcgacgtg cacaacaacg tgctcaccgt
      361 cacgggcgag tccaaggtcg aggagaagcg cgacgagaac gggtacgccg tccgcgaacg
      421 gcggttcggc
//