LOCUS GO479265 613 bp mRNA linear EST 25-NOV-2009 DEFINITION Aa_aamk2_22C03_T7 Aphelenchus avenae mixed-stage library Aphelenchus avenae cDNA clone Aa_aamk2_22C03 5', mRNA sequence. ACCESSION GO479265 VERSION GO479265.1 DBLINK BioSample: SAMN00167490 KEYWORDS EST. SOURCE Aphelenchus avenae ORGANISM Aphelenchus avenae Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida; Tylenchina; Tylenchomorpha; Aphelenchoidea; Aphelenchidae; Aphelenchus. REFERENCE 1 (bases 1 to 613) AUTHORS Karim,N., Jones,J.T., Okada,H. and Kikuchi,T. TITLE Analysis of expressed sequence tags and identification of genes encoding cell-wall-degrading enzymes from the fungivorous nematode Aphelenchus avenae JOURNAL BMC Genomics 10 (1), 525 (2009) PUBMED 19917084 COMMENT Contact: Taisei Kikuchi Forestry and Forest Products Research Institute 1, matunosato, Tsukuba, Ibaraki 305-8687, Japan Email: kikuchit@affrc.go.jp cDNA inserts were sequenced from the 5 end using the T7 primer and BigDye 3.1 (ABI) on an ABI 3100 DNA sequencer. Raw sequence trace data were processed for submission to dbEST by trace2dbest software (http://www.nematodes.org). Plate: 22 row: C column: 03 Seq primer: T7(GTAATACGACTCACTATAGGGC). FEATURES Location/Qualifiers source 1..613 /organism="Aphelenchus avenae" /mol_type="mRNA" /db_xref="taxon:70226" /clone="Aa_aamk2_22C03" /clone_lib="SAMN00167490 Aphelenchus avenae mixed-stage library" /dev_stage="mixed" /note="Vector: PSPORT1; Site_1: SalI; Site_2: NotI; To obtain mixed-stage nematodes, the nematodes were cultured on fungi (Botrytis cinerea grown on autoclaved barley) for 3 weeks at 25C and then extracted for 3h at 25C using the Baermann funnel technique. Poly(A)+ RNA was extracted using Sepasol (Nakalai) and subsequently FastTrack MAG micro mRNA Isolation Kits (Invitrogen). The cDNA was synthesized using the SMART technology (Clontech) and cloned into pSPORT1 using an Adaptor (SalI-SmaI, TAKARA). The plasmid construct was transformed into E. coli DH5a by electroporation." BASE COUNT 146 a 160 c 175 g 132 t ORIGIN 1 tatgggatgc cgcatgtcgc ggacgcgcag tcatccggat ctagtcggaa aagcgtcatc 61 gtcgtcgtat aacgccgttt cctcttccgc cgacgagaac tcattcgatt ccatccctga 121 aagtgcgatg ggctccaagt cgtcgaaagc gaacggtcac catcacaatc attccaacgg 181 ccacgtggtg caggtggcga caatgaacgg cacgcacaag ccggggatcg agaatgcgaa 241 ttcgccgaat tcacagcggc cgaaagtggg caaggtctcg aatgggcaag cggttttgct 301 gaggagagac actccagcag gtggactatt cgaaaatccg ccggctgccc cagcgcctcc 361 tacgtctaac gggtcaagtg acttactgtt ctgtcagaag ccgatctcac aggttgaaag 421 cgccagtcag gcggacttct tccggatgct ggacgagaaa attgctcaag gtgccaaaga 481 tattgcggaa tcggatttgg acgactagag cgtcgattcg ttgtgctttc ttgacggagt 541 atcccaacga aagcgccgtc agagcgggaa gatatcactg ttcgtggtta gctgcttagg 601 atccttctac ttg //