LOCUS       BAG70253.1               196 aa    PRT              HUM 02-SEP-2008
DEFINITION  Homo sapiens platelet-derived growth factor alpha isoform
            2 preproprotein protein.
ACCESSION   AB451439-1
PROTEIN_ID  BAG70253.1
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 588)
  AUTHORS   Kawamura,Y., Nomura,N. and Goshima,N.
  TITLE     Direct Submission
  JOURNAL   Submitted (31-JUL-2008) to the DDBJ/EMBL/GenBank databases.
            Contact:Naoki Goshima
            Biomedicinal Information Research Center (BIRC), National
            Institute of Advanced Industrial Science and Technology (AIST);
            2-42 Aomi, Koto-ku, Tokyo 135-0064, Japan
REFERENCE   2
  AUTHORS   Goshima,N., Kawamura,Y., Fukumoto,A., Miura,A., Honma,R.,
            Satoh,R., Wakamatsu,A., Yamamoto,J.-I., Kimura,K., Nishikawa,T.,
            Andoh,T., Iida,Y., Ishikawa,K., Ito,E., Kagawa,N., Kaminaga,C.,
            Kanehori,K., Kawakami,B., Kenmochi,K.-I., Kimura,R., Kobayashi,M.,
            Kuroita,T., Kuwayama,H., Maruyama,Y., Matsuo,K., Minami,K.,
            Mitsubori,M., Mori,M., Morishita,R., Murase,A., Nishikawa,A.,
            Nishikawa,S., Okamoto,T., Sakagami,N., Sakamoto,Y., Sasaki,Y.,
            Seki,T., Sono,S., Sugiyama,A., Sumiya,T., Takayama,T.,
            Takayama,Y., Takeda,H., Togashi,T., Yahata,K., Yamada,H.,
            Yanagisawa,Y., Endo,Y., Imamoto,F., Kisu,Y., Tanaka,S., Isogai,T.,
            Imai,J.-I., Watanabe,S. and Nomura,N.
  TITLE     Human Protein Factory: an infrastructure to convert the human
            transcriptome into the in vitro-expressed human proteome of
            versatile utility
  JOURNAL   Unpublished (2008)
COMMENT     This human Gateway entry clone was constructed by recombining an
            attB-attached open reading frame (ORF) fragment with attP
            sequences of the Gateway donor vector pDONR201. The ORF sequence
            in the entry clone is flanked with attL1 sequence (100 nt) -
            spacer nucleotides (TC) - Shine-Dalgano sequence (GAAGGAGATA) -
            spacer nucleotides (GA) - Kozak sequence (ACC) upstream of the
            translational initiation codon (ATG) and is also flanked with
            spacer nucleotides (TATG) - attL2 sequence (99 nt) downstream of
            the ORF. This is an F-type clone that deletes the stop codon for
            C-terminal tagged proteins. DNA sequences of the entire ORF and
            flanking regions were validated by sequencing. Clone structure of
            the ORF and flanking sequences is as follows:
            5'-caaataatgattttattttgactgatagtgacctgttcgttgcaacaaattgatgagcaatgct
            tttttataatgccaactttgtacaaaaaagcaggct TC GAAGGAGATA GA ACC 5'ORF3'
            TATG acccagctttcttgtacaaagttggcattataagaaagcattgcttatcaatttgttgcaac
            gaacaggtcactatcagtcaaaataaaatcattattg-3' (5'ORF3'; ORF sequence.
            attL sequences are described in lower cases).
            Clone information: http://www.HGPD.jp/
            This clone was produced in the "Functional Analysis of Protein and
            Research Application" project supported by the New Energy and
            Industrial Technology Development Organization (NEDO), Japan
FEATURES             Qualifiers
     source          /clone="FLJ08166AAAF"
                     /db_xref="H-InvDB:HIT000487652"
                     /db_xref="taxon:9606"
                     /mol_type="mRNA"
                     /note="Vector: pDONR201"
                     /organism="Homo sapiens"
     protein         /gene="PDGFA"
                     /transl_table=1
BEGIN
        1 MRTLACLLLL GCGYLAHVLA EEAEIPREVI ERLARSQIHS IRDLQRLLEI DSVGSEDSLD
       61 TSLRAHGVHA TKHVPEKRPL PIRRKRSIEE AVPAVCKTRT VIYEIPRSQV DPTSANFLIW
      121 PPCVEVKRCT GCCNTSSVKC QPSRVHHRSV KVAKVEYVRK KPKLKEVQVR LEEHLECACA
      181 TTSLNPDYRE EDTDVR
//