LOCUS AFI23764.1 209 aa PRT INV 24-APR-2012 DEFINITION Anopheles homunculus cytochrome c oxidase subunit I protein. ACCESSION JQ291233-1 PROTEIN_ID AFI23764.1 SOURCE mitochondrion Anopheles homunculus ORGANISM Anopheles homunculus Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Endopterygota; Diptera; Nematocera; Culicoidea; Culicidae; Anophelinae; Anopheles. REFERENCE 1 (bases 1 to 629) AUTHORS da Cardoso,J.C., Bergo,E.S., Oliveira,T.M., Sant'ana,D.C., Motoki,M.T. and Sallum,M.A. TITLE New records of Anopheles homunculus in central and serra do mar biodiversity corridors of the Atlantic Forest, Brazil JOURNAL J. Am. Mosq. Control Assoc. 28 (1), 1-5 (2012) PUBMED 22533076 REFERENCE 2 (bases 1 to 629) AUTHORS Cardoso,J.C., Bergo,E.S., Oliveira,T.M.P., Sant'Ana,D.C., Motoki,M.T. and Sallum,M.A.M. TITLE Direct Submission JOURNAL Submitted (15-DEC-2011) Epidemiologia, Faculdade de Saude Publica, Universidade de Sao Paulo, Avenida Doutor Arnaldo 715, Sao Paulo, Sao Paulo 01246904, Brazil FEATURES Qualifiers source /organism="Anopheles homunculus" /organelle="mitochondrion" /mol_type="genomic DNA" /isolate="BA22_31" /specimen_voucher="FSP-USP:BA22_31" /db_xref="taxon:369908" /sex="male" /dev_stage="adult" /country="Brazil: Bahia state, Camacan, Reserva Serra Bonita" /collection_date="04-Oct-2009" /collected_by="Sallum MAM and Bergo ES" /PCR_primers="fwd_name: LCO1490, fwd_seq: ggtcaacaaatcataaagatattg, rev_name: HCO2198, rev_seq: taaacttcagggtgaccaaaaaatca" /note="larval and pupal exuviae, male genitilia kept as vouchers" protein /gene="COI" /transl_table=5 BEGIN 1 WAGMVGTSLS ILIRAELGHP GAFIGDDQIY NVIVTAHAFI MIFFMVMPIM IGGFGNWLVP 61 LMLGAPDMAF PRMNNMSFWM LPPSLTLLVS SSMVESGAGT GWTVYPPLSS GIAHAGASVD 121 LAIFSLHLAG ISSILGAVNF ITTVINMRSP GITLDRMPLF VWSVVITAIL LLLSLPVLAG 181 AITMLLTDRN LNTSFFDPAG GGDPILYQH //