LOCUS ABL96617.1 15 aa PRT HUM 22-FEB-2012 DEFINITION Homo sapiens truncated PRDM1 isoform 2 protein. ACCESSION EF151143-1 PROTEIN_ID ABL96617.1 SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 367) AUTHORS Staege,M.S., Banning-Eichenseer,U., Weissflog,G., Volkmer,I., Burdach,S., Richter,G., Mauz-Korholz,C., Foll,J. and Korholz,D. TITLE Gene expression profiles of Hodgkin's lymphoma cell lines with different sensitivity to cytotoxic drugs JOURNAL Exp. Hematol. 36 (7), 886-896 (2008) PUBMED 18400362 REFERENCE 2 (bases 1 to 367) AUTHORS Staege,M.S., Volkmer,I. and Heins,S. TITLE Direct Submission JOURNAL Submitted (28-NOV-2006) Children's Cancer Research Center, Martin-Luther-University Halle-Wittenberg, Ernst-Grube-Str. 40, Halle 06097, Germany FEATURES Qualifiers source /db_xref="H-InvDB:HIT000394955" /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="6" /map="6q21-q22.1" /cell_line="L-540" /cell_type="Hodgkin's lymphoma" /PCR_primers="fwd_seq: gtggtgggttaatcggtttg, rev_seq: atagcgcatccagttgcttt" protein /gene="PRDM1" /note="PR domain containing 1 with ZNF domain isoform 2" BEGIN 1 MEKVTDKSVP YLFPP //