LOCUS AKC57772.1 80 aa PRT PRI 31-AUG-2015 DEFINITION Gorilla gorilla gorilla MHC class II antigen protein. ACCESSION KP872291-1 PROTEIN_ID AKC57772.1 SOURCE Gorilla gorilla gorilla (western lowland gorilla) ORGANISM Gorilla gorilla gorilla Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Gorilla. REFERENCE 1 (bases 1 to 241) AUTHORS Hans,J.B., Haubner,A., Arandjelovic,M., Bergl,R.A., Funfstuck,T., Gray,M., Morgan,D.B., Robbins,M.M., Sanz,C. and Vigilant,L. TITLE Characterization of MHC class II B polymorphism in multiple populations of wild gorillas using non-invasive samples and next-generation sequencing JOURNAL Am. J. Primatol. (2015) In press PUBMED 26283172 REMARK Publication Status: Available-Online prior to print REFERENCE 2 (bases 1 to 241) AUTHORS Hans,J.B. TITLE Direct Submission JOURNAL Submitted (03-MAR-2015) Primatology, Max Planck Institute for Evolutionary Anthropology, Deutscher Platz 6, Leipzig, Saxony 04103, Germany COMMENT ##Assembly-Data-START## Assembly Method :: leeHom published in Nucl. Acids Res. (13 October 2014) 42 (18): e141. v. 2014 Sequencing Technology :: Illumina ##Assembly-Data-END## FEATURES Qualifiers source /organism="Gorilla gorilla gorilla" /mol_type="genomic DNA" /sub_species="gorilla" /db_xref="taxon:9595" /country="Democratic Republic of the Congo: Goualougo Triangle in the Nouabale-Ndoki National Park" /PCR_primers="fwd_name: gh46, fwd_seq: ccggatccttcgtgtccccacagcacg, rev_name: ab60, rev_seq: ccgaattccgctgcactgtgaagctctc" protein /gene="DRB6" /allele="DRB6-WLG1" BEGIN 1 FLEQAKCECH ILNGTERVQY LNRYIHKREE NLRFDSDVGE FQAVTELGRP VAEKWNSQKE 61 ILEEKRDKVD TYCRYSYGVF //